Page generated on Fri Oct 15 12:01:49 2010

dme-mir-1005




dme-mir-1005

View dme-mir-1005 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-100511056224141520412175204414


GCCATGATGCCCACCATTCTGACCTGTGAGTTGATCGATTTCGAGGTTTTGGCACACGAATATAATCTGGAATCTTTAATTCGCAGTTCCCACCGAAATGTCAGTGTTCG
.........................(((((((((..((((((.((((((((.....)))....))))))))))).)))))))))..........................-17.00
..................((((((((((((((((..((((((.((((((((.....)))....))))))))))).))))))))))).............)))))......-23.81
Sense strand
                                                                                                              SizeBlastTotalGSM379057 Krimp Mutant SRR031696_2152 GSM379065 Zuc Heterozygote SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR029633 total small RNAs from hen1 homozygous flies SRR031703 Total small RNAs from r2d2 homozygous flies V097 CS ovarySRR031701 Total small RNAs from r2d2 heterozygous flies GSM379064 Vasa Mutant SRR031697 Total small RNAs from dcr-2 heterozygous flies V098 dcr-2[L811fsX] ovaryV082 embryo 14-24hrSRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR031699 Total small RNAs from dcr-2 homozygous flies SRR031692 Total small RNAs from Oregon R V063 CS,ovary,AGO1IPS29 male head #1V088 r2d2[1] ovary total RNA  GSM379056 Krimp Heterozygote SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V065 dcr-2[L811fsX], ovary, AGO1IPSRR014273 Ovary_rep1_Har_P V001 IR-SRR001347 ago2 untreated V002 IR+GSM379051 Armi Mutant V066 r2d2[1], ovary, AGO1IPSRR014275 Ovary_rep1 LK_P SRR001338 IR non-beta-eliminated SRR001349 heterozygous dcr-2_untreated V081 embryo 2-6hrV064 ago2[414], ovary, AGO1IPV019 GM2 cellSRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 V090 CS  male total RNA  SRR001664 homozygous dcr-2_untreated SRR014280 Ovary_rep1 w1118_P GSM280083 dcr-2-/- ovaries (18-29nt) GSM379050 Armi Heterozygote SRR014277 Ovary_rep1 NA_P GSM379060 SpnE Heterozygote S28 0-2d pupaeV089 ago2[414] ovary total RNA  V083 male, one dayGSM379054 Flam Heterozygote S22 female head #1V018 Kc167 cellV008 S2-DRSCV084 female, one dayGSM379066 Zuc Mutant GSM379062 Squ Mutant GSM280084 loqs-/- ovaries (18-29nt) V026 1182-4H cellGSM379061 Squ Heterozygote OSS6 Drosophila OSS cell small RNA libraries, rep2 V024 kc167 cellS24 male body #2GSM280088 S2cell (AGO1IP) OSS7 Drosophila OSS cell small RNA libraries, rep3 SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies OSS8 Drosophila OSS cell small RNA libraries, rep4 OSS2 Drosophila OSS cell small RNA libraries, rep1 S2 female headSRR014282 Ovary_rep1 wK_P GSM379063 Vasa Heterozygote GSM379052 Aub Heterozygote S10 2-6h #1 (8)V076 ML-DmBG3-C2S1 male headGSM467729 WT GSM280082 WT ovaries (18-29nt) GSM379058 SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 S23 female body #2V075 ML-DmBG1-C1SRR029030 dcr-2 knockdown GSM467730 r2d2 GSM379059 SRR029028 untreated (mock) S12 6-10h #1 (10)V009 CMEL1S13 6-10h #2 (11)V010 MLDmD20c5SRR032095 AGO1 IP dcr2 knockdown SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies V067 S2-NPS9 0-1h #3 (7)SRR001343 dcr-2 non-beta-eliminated SRR032093 ago1 knockdown S19 2-4day pupae #1GSM379055 Flam Mutant V021 ML-DmD21 cellSRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb GSM180328 adult heads (female heads, male heads) S21 disk #2GSM379067 SpnE Mutant SRR029031 loqs-ORF knockdown SRR001345 ago2 non-beta-eliminated SRR023399 RNA bound by P19 protein V033 CMEW1 Cl.8+ cellS7 12-24hr embryoS18 3rd inster #2GSM467731 loq S3 male bodyV025 S2R+ cellGSM343287 Drosophila Toll 10b mutant embryos S27 0-1d Pupae (w)S17 3rd inster #1S26 1st instar #2GSM180333 late embryo (12-24) SRR001341 WT_males non-beta-eliminated S32 s2+48 #2SRR010959 Ago3 IP in heterozygotes S5 imaginal discSRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized GSM280085 WT testes (18-24nt) S4 female bodyS31 s2+48 #1SRR031693_4 SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies V028 CMEW1 Cl.8+ cellS25 1st instar #1SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day S34 KC+48 #1S15 S2 -48 #1S20 2-4day pupae#2SRR010955 Aub IP in Ago3 heterozygotes GSM239041 fly heads, non beta-eliminated S35 KC+48 #2GSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) S11 2-6h #2 (9)GSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown GSM180332 mid embryo (6-10) S14 0-1hr #1 (A)S16 KC -48 #1GSM180335 imaginal discs GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR010957 Aub IP in Ago3 trans-heterozygotes SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb SRR010952 Ago3 trans-heterozygotes, oxidized SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries S33 KC-48 #2GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown S8 S2-48,+48, KC-48, +48 mixGSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownSRR001344 dcr-2 beta-eliminated GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S30 s2-48 #2V011 Sg4SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM239052 S2 cells, non beta-eliminated GSM424739 S2 parental GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated SRR010951 Ago3 heterozygotes, oxidized SRR010953 Aub heterozygotes, oxidized
.........................GTGAGTTGATCGATTTCGAGGTTTT............................................................2511000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................GTGAGTTGATCGATTTCGAGGT...............................................................22120000100300062100001100100000000100000000000100010000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................GTGAGTTGATCGATTTCGAG.................................................................2011000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................GTGAGTTGATCGATTTCGAGG................................................................2113000000010000000000000000000000000000000100000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................GTGAGTTGATCGATTTCGAGGTT..............................................................23138112011210571204162411201667035120051256042310101018910506010120200050000001120001202020001120010000000000000000000000000000000002000000000000000000000000000000000000000000000000000000000000000000000
.........................GTGAGTTGATCGATTTCGAGGTTT.............................................................2415000000200020000000000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................GTGAGTTGATCGATTTCGA..................................................................1913000000000020000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
....................................GATTTCGAGGTTTTGGCACA......................................................2012000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................GTTTTGGCACACGAATATAA.............................................2011000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................................................ATCTGGAATCTTTAATTCGCAGT.......................2311000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................................................ATCTGGAATCTTTAATTCGCAG........................2213000000000000000000000000000000000000000001000100000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................TCTGGAATCTTTAATTCGCAGTT......................2311131221306641110201704105610213121034010013310101001110010110100000000000100002000000003000000100600001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................TCTGGAATCTTTAATTCGCA.........................2014246161020303162545932121432532425160512750019055304203140576322124043022011021032401022412302010222420121001002020201000001320130100021100000000000000000000000000000000000000000000000000000000000000000
.................................................................TCTGGAATCTTTAATTCGCAGT.......................22112701152397681074710303282150272832293030143334435152725132191221332088137251984844523123711211111008115821351642054372400237132103220003250113143103430000100000000011101100000000000000000000000000000000000000000000000000000000000
.................................................................TCTGGAATCTTTAATTCGC..........................191141181412270140300054320002004101039013054202000000021000000011000000000000000000401000000000270010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................TCTGGAATCTTTAATTCG...........................18119000020010010010010000001000013001023000000000000000000010000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000
.................................................................TCTGGAATCTTTAATTCGCAG........................2113208162238156143192155461051071233738579684674648494763344165375543395344738293122342235262030978231361291917915889377118510812142511410911532263117740745205435162302421100341001013103120201110010011000000000000000000000000000000000000000000000000000000000
..................................................................CTGGAATCTTTAATTCGCAGT.......................2115000000001000000001000000000000000000000000000000000000001000100000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................CTGGAATCTTTAATTCGCAG........................20115010002050400001000000000000000010000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................TGGAATCTTTAATTCGCAGT.......................2012000000000000000000010010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................TGGAATCTTTAATTCGCAG........................1912000010000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
....................................................................GGAATCTTTAATTCGCAGT.......................1911000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
......................................................................................TTCCCACCGAAATGTCAGTGT...2111000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                              SizeBlastTotalGSM379057 Krimp Mutant SRR031696_2152 GSM379065 Zuc Heterozygote SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR029633 total small RNAs from hen1 homozygous flies SRR031703 Total small RNAs from r2d2 homozygous flies V097 CS ovarySRR031701 Total small RNAs from r2d2 heterozygous flies GSM379064 Vasa Mutant SRR031697 Total small RNAs from dcr-2 heterozygous flies V098 dcr-2[L811fsX] ovaryV082 embryo 14-24hrSRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR031699 Total small RNAs from dcr-2 homozygous flies SRR031692 Total small RNAs from Oregon R V063 CS,ovary,AGO1IPS29 male head #1V088 r2d2[1] ovary total RNA  GSM379056 Krimp Heterozygote SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V065 dcr-2[L811fsX], ovary, AGO1IPSRR014273 Ovary_rep1_Har_P V001 IR-SRR001347 ago2 untreated V002 IR+GSM379051 Armi Mutant V066 r2d2[1], ovary, AGO1IPSRR014275 Ovary_rep1 LK_P SRR001338 IR non-beta-eliminated SRR001349 heterozygous dcr-2_untreated V081 embryo 2-6hrV064 ago2[414], ovary, AGO1IPV019 GM2 cellSRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 V090 CS  male total RNA  SRR001664 homozygous dcr-2_untreated SRR014280 Ovary_rep1 w1118_P GSM280083 dcr-2-/- ovaries (18-29nt) GSM379050 Armi Heterozygote SRR014277 Ovary_rep1 NA_P GSM379060 SpnE Heterozygote S28 0-2d pupaeV089 ago2[414] ovary total RNA  V083 male, one dayGSM379054 Flam Heterozygote S22 female head #1V018 Kc167 cellV008 S2-DRSCV084 female, one dayGSM379066 Zuc Mutant GSM379062 Squ Mutant GSM280084 loqs-/- ovaries (18-29nt) V026 1182-4H cellGSM379061 Squ Heterozygote OSS6 Drosophila OSS cell small RNA libraries, rep2 V024 kc167 cellS24 male body #2GSM280088 S2cell (AGO1IP) OSS7 Drosophila OSS cell small RNA libraries, rep3 SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies OSS8 Drosophila OSS cell small RNA libraries, rep4 OSS2 Drosophila OSS cell small RNA libraries, rep1 S2 female headSRR014282 Ovary_rep1 wK_P GSM379063 Vasa Heterozygote GSM379052 Aub Heterozygote S10 2-6h #1 (8)V076 ML-DmBG3-C2S1 male headGSM467729 WT GSM280082 WT ovaries (18-29nt) GSM379058 SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 S23 female body #2V075 ML-DmBG1-C1SRR029030 dcr-2 knockdown GSM467730 r2d2 GSM379059 SRR029028 untreated (mock) S12 6-10h #1 (10)V009 CMEL1S13 6-10h #2 (11)V010 MLDmD20c5SRR032095 AGO1 IP dcr2 knockdown SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies V067 S2-NPS9 0-1h #3 (7)SRR001343 dcr-2 non-beta-eliminated SRR032093 ago1 knockdown S19 2-4day pupae #1GSM379055 Flam Mutant V021 ML-DmD21 cellSRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb GSM180328 adult heads (female heads, male heads) S21 disk #2GSM379067 SpnE Mutant SRR029031 loqs-ORF knockdown SRR001345 ago2 non-beta-eliminated SRR023399 RNA bound by P19 protein V033 CMEW1 Cl.8+ cellS7 12-24hr embryoS18 3rd inster #2GSM467731 loq S3 male bodyV025 S2R+ cellGSM343287 Drosophila Toll 10b mutant embryos S27 0-1d Pupae (w)S17 3rd inster #1S26 1st instar #2GSM180333 late embryo (12-24) SRR001341 WT_males non-beta-eliminated S32 s2+48 #2SRR010959 Ago3 IP in heterozygotes S5 imaginal discSRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized GSM280085 WT testes (18-24nt) S4 female bodyS31 s2+48 #1SRR031693_4 SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies V028 CMEW1 Cl.8+ cellS25 1st instar #1SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day S34 KC+48 #1S15 S2 -48 #1S20 2-4day pupae#2SRR010955 Aub IP in Ago3 heterozygotes GSM239041 fly heads, non beta-eliminated S35 KC+48 #2GSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) S11 2-6h #2 (9)GSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown GSM180332 mid embryo (6-10) S14 0-1hr #1 (A)S16 KC -48 #1GSM180335 imaginal discs GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR010957 Aub IP in Ago3 trans-heterozygotes SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb SRR010952 Ago3 trans-heterozygotes, oxidized SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries S33 KC-48 #2GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown S8 S2-48,+48, KC-48, +48 mixGSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownSRR001344 dcr-2 beta-eliminated GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S30 s2-48 #2V011 Sg4SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM239052 S2 cells, non beta-eliminated GSM424739 S2 parental GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated SRR010951 Ago3 heterozygotes, oxidized SRR010953 Aub heterozygotes, oxidized