Page generated on Fri Oct 15 12:01:44 2010

dme-mir-137




dme-mir-137

View dme-mir-137 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-13714027349515512680111526801551


CCAAGTGGATTACGATGGCGTCGCCAATCTCCAATGGCCACGTGTATGCTCGTAGCTATAACCTGAAATCCAAATGTTATTGCTTGAGAATACACGTAGTTCACCGAGATTTGTTCAGCAATAAAAAGAGCGAAACCCGT
.........................((((((...((..(((((((((.((((.(((.(((((.((.....))...))))).))))))).)))))))).)..))..)))))).............................-28.00
....((((((((((...((((.((((........)))).))))((((.((((.(((.(((((.((.....))...))))).))))))).)))).))))))))))((.(.(((((((...........))))))).).)).-39.80
Sense strand
                                                                                                                                            SizeBlastTotalSRR029633 total small RNAs from hen1 homozygous flies SRR031697 Total small RNAs from dcr-2 heterozygous flies V082 embryo 14-24hrSRR031692 Total small RNAs from Oregon R SRR031703 Total small RNAs from r2d2 homozygous flies SRR031699 Total small RNAs from dcr-2 homozygous flies SRR031696_2152 SRR031701 Total small RNAs from r2d2 heterozygous flies V090 CS  male total RNA  SRR001349 heterozygous dcr-2_untreated SRR001338 IR non-beta-eliminated SRR001664 homozygous dcr-2_untreated S29 male head #1V083 male, one daySRR001347 ago2 untreated V001 IR-V084 female, one dayV002 IR+V024 kc167 cellV018 Kc167 cellSRR001345 ago2 non-beta-eliminated S24 male body #2S22 female head #1S2 female headSRR001343 dcr-2 non-beta-eliminated SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies SRR001348 ago2 oxidized SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies V009 CMEL1GSM424740 S2 pKF63 stably transfected SRR001344 dcr-2 beta-eliminated GSM467729 WT SRR001341 WT_males non-beta-eliminated SRR001339 WT_females non-beta-eliminated V098 dcr-2[L811fsX] ovaryS7 12-24hr embryoS1 male headS21 disk #2S23 female body #2SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies V081 embryo 2-6hrGSM467730 r2d2 S5 imaginal discS28 0-2d pupaeGSM280085 WT testes (18-24nt) S9 0-1h #3 (7)GSM467731 loq V097 CS ovaryGSM180328 adult heads (female heads, male heads) SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies V008 S2-DRSCV033 CMEW1 Cl.8+ cellS26 1st instar #2S27 0-1d Pupae (w)SRR031693_4 GSM180333 late embryo (12-24) V076 ML-DmBG3-C2V028 CMEW1 Cl.8+ cellS25 1st instar #1S19 2-4day pupae #1V075 ML-DmBG1-C1GSM379059 V063 CS,ovary,AGO1IPS3 male bodyS35 KC+48 #2GSM246084 D. melanogaster adult male heads 454 V064 ago2[414], ovary, AGO1IPV088 r2d2[1] ovary total RNA  SRR001337 WT_females beta-eliminated V089 ago2[414] ovary total RNA  S4 female bodySRR001340 IR beta-eliminated V065 dcr-2[L811fsX], ovary, AGO1IPV066 r2d2[1], ovary, AGO1IPGSM239041 fly heads, non beta-eliminated V019 GM2 cellS34 KC+48 #1GSM239052 S2 cells, non beta-eliminated GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated S12 6-10h #1 (10)SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 GSM180335 imaginal discs SRR029033 lacZ knockdown S33 KC-48 #2V026 1182-4H cellSRR029032 r2d2 knockdown V011 Sg4SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM379060 SpnE Heterozygote S17 3rd inster #1GSM280087 S2cell (AGO2IP) SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM379065 Zuc Heterozygote S32 s2+48 #2S13 6-10h #2 (11)GSM379063 Vasa Heterozygote GSM280084 loqs-/- ovaries (18-29nt) S18 3rd inster #2SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S20 2-4day pupae#2SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 SRR032094 ago2 knockdown S16 KC -48 #1OSS8 Drosophila OSS cell small RNA libraries, rep4 GSM379054 Flam Heterozygote SRR014273 Ovary_rep1_Har_P OSS7 Drosophila OSS cell small RNA libraries, rep3 SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb S30 s2-48 #2SRR010955 Aub IP in Ago3 heterozygotes OSS6 Drosophila OSS cell small RNA libraries, rep2 SRR029028 untreated (mock) GSM379066 Zuc Mutant GSM180332 mid embryo (6-10) GSM379056 Krimp Heterozygote SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR014275 Ovary_rep1 LK_P OSS2 Drosophila OSS cell small RNA libraries, rep1 GSM379064 Vasa Mutant GSM379053 Aub Mutant GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown GSM280088 S2cell (AGO1IP) GSM379062 Squ Mutant V025 S2R+ cellGSM379061 Squ Heterozygote GSM343287 Drosophila Toll 10b mutant embryos V067 S2-NPS10 2-6h #1 (8)GSM280083 dcr-2-/- ovaries (18-29nt) GSM379067 SpnE Mutant GSM379058 GSM280086 WT ovaries (AGO2IP) S11 2-6h #2 (9)SRR014282 Ovary_rep1 wK_P GSM239051 S2 cells, beta-eliminated S14 0-1hr #1 (A)GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown S31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V020 S2R+ cellSRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells GSM379052 Aub Heterozygote GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM239050 fly heads, beta-eliminated SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars SRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P GSM180331 early embryo (2-6) SRR014277 Ovary_rep1 NA_P S8 S2-48,+48, KC-48, +48 mixGSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellS15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 GSM379051 Armi Mutant SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM280082 WT ovaries (18-29nt) SRR023399 RNA bound by P19 protein SRR029030 dcr-2 knockdown GSM424739 S2 parental SRR032093 ago1 knockdown SRR010951 Ago3 heterozygotes, oxidized GSM379057 Krimp Mutant SRR010953 Aub heterozygotes, oxidized
.............GATGGCGTCGCCAATCTCC............................................................................................................1911000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
......................................CACGTGTATGCTCGTAGCTATAA...............................................................................2312000110000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
......................................CACGTGTATGCTCGTAGCTAT.................................................................................2113110100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
......................................CACGTGTATGCTCGTAGCT...................................................................................1915100111000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................ACGTGTATGCTCGTAGCTATA................................................................................21124312020520000000001041000100001000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................ACGTGTATGCTCGTAGCTATAA...............................................................................22121311010011000000105100000000030000000000000100000010000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................ACGTGTATGCTCGTAGCTAT.................................................................................20130800264150010001001000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................ACGTGTATGCTCGTAGCTA..................................................................................1912100000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................ACGTGTATGCTCGTAGCT...................................................................................1812100000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................ACGTGTATGCTCGTAGCTATAAC..............................................................................231456502196266510153212031324119116046343000003010220301100030001000002003000000000000001000000000500000000100001000100000000000000010000000000000000000000000000000000000000000000000000000000000000000000000
........................................CGTGTATGCTCGTAGCTATAAC..............................................................................2212000000010000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................................TTATTGCTTGAGAATACACG............................................2011000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................................TTATTGCTTGAGAATACACGT...........................................2114000000100000000010000010000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................................TTATTGCTTGAGAATACACGTAG.........................................23125302201303010600000100000000200000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................................TTATTGCTTGAGAATACACGTA..........................................2216112000100000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................TATTGCTTGAGAATACACGTAGTT.......................................2417000000000000000000410000000000001000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................TATTGCTTGAGAATACAC.............................................18111001100000000000000001000000410000000000000000000000000020000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................TATTGCTTGAGAATACACGT...........................................20166555422296535103507491612628133114381910102021141013112011010100001000200010000000100001001011100000000001000000100000000000010000001001000000000001001000000000000000000000000000000000000000000000000000000000
.............................................................................TATTGCTTGAGAATACACG............................................19128420200210310001100010000001121000000000010000100001010000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................TATTGCTTGAGAATACACGTA..........................................211274928716053145320113408223262665469311076724651340224992271057645091995022241100222227220030230021111030100102210202001000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................TATTGCTTGAGAATACACGTAGT........................................2313941116621216142720306651781154122617310015000212013113102005400102400000000110010001000000000000000010001000000000000000000000000000100000000000010000000000000000000000000000000000000000000000000000000000000
.............................................................................TATTGCTTGAGAATACACGTAG.........................................22122515289220102041177612721577104910629898017026986375685995364104023401781751371199464585654424346443639394246464342293933383934262725241821201820121312101212101210118578795774455353033442444133232333233222212222221100111111111100110000000000000000000000000000000000000000000000000000000000
..............................................................................ATTGCTTGAGAATACACGT...........................................19110010141110010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................ATTGCTTGAGAATACACGTAGT........................................22114220101001000700000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................ATTGCTTGAGAATACACGTA..........................................20115410220220010001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................ATTGCTTGAGAATACACGTAG.........................................211284543410263520222430620113037430103020000302200000100101000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................TTGCTTGAGAATACACGTAGT........................................2112000000000000000010000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................TTGCTTGAGAATACACGTAGTT.......................................2215000000101001010000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................TTGCTTGAGAATACACGTAG.........................................20145481207420000000500000200000000000000000110000000001000000001000000600000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................................................................TGCTTGAGAATACACGTAG.........................................1916101002000000000101000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................GCTTGAGAATACACGTAG.........................................18115011100000000010103000000000000001000000000000050000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                                            SizeBlastTotalSRR029633 total small RNAs from hen1 homozygous flies SRR031697 Total small RNAs from dcr-2 heterozygous flies V082 embryo 14-24hrSRR031692 Total small RNAs from Oregon R SRR031703 Total small RNAs from r2d2 homozygous flies SRR031699 Total small RNAs from dcr-2 homozygous flies SRR031696_2152 SRR031701 Total small RNAs from r2d2 heterozygous flies V090 CS  male total RNA  SRR001349 heterozygous dcr-2_untreated SRR001338 IR non-beta-eliminated SRR001664 homozygous dcr-2_untreated S29 male head #1V083 male, one daySRR001347 ago2 untreated V001 IR-V084 female, one dayV002 IR+V024 kc167 cellV018 Kc167 cellSRR001345 ago2 non-beta-eliminated S24 male body #2S22 female head #1S2 female headSRR001343 dcr-2 non-beta-eliminated SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies SRR001348 ago2 oxidized SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies V009 CMEL1GSM424740 S2 pKF63 stably transfected SRR001344 dcr-2 beta-eliminated GSM467729 WT SRR001341 WT_males non-beta-eliminated SRR001339 WT_females non-beta-eliminated V098 dcr-2[L811fsX] ovaryS7 12-24hr embryoS1 male headS21 disk #2S23 female body #2SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies V081 embryo 2-6hrGSM467730 r2d2 S5 imaginal discS28 0-2d pupaeGSM280085 WT testes (18-24nt) S9 0-1h #3 (7)GSM467731 loq V097 CS ovaryGSM180328 adult heads (female heads, male heads) SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies V008 S2-DRSCV033 CMEW1 Cl.8+ cellS26 1st instar #2S27 0-1d Pupae (w)SRR031693_4 GSM180333 late embryo (12-24) V076 ML-DmBG3-C2V028 CMEW1 Cl.8+ cellS25 1st instar #1S19 2-4day pupae #1V075 ML-DmBG1-C1GSM379059 V063 CS,ovary,AGO1IPS3 male bodyS35 KC+48 #2GSM246084 D. melanogaster adult male heads 454 V064 ago2[414], ovary, AGO1IPV088 r2d2[1] ovary total RNA  SRR001337 WT_females beta-eliminated V089 ago2[414] ovary total RNA  S4 female bodySRR001340 IR beta-eliminated V065 dcr-2[L811fsX], ovary, AGO1IPV066 r2d2[1], ovary, AGO1IPGSM239041 fly heads, non beta-eliminated V019 GM2 cellS34 KC+48 #1GSM239052 S2 cells, non beta-eliminated GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated S12 6-10h #1 (10)SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 GSM180335 imaginal discs SRR029033 lacZ knockdown S33 KC-48 #2V026 1182-4H cellSRR029032 r2d2 knockdown V011 Sg4SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM379060 SpnE Heterozygote S17 3rd inster #1GSM280087 S2cell (AGO2IP) SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM379065 Zuc Heterozygote S32 s2+48 #2S13 6-10h #2 (11)GSM379063 Vasa Heterozygote GSM280084 loqs-/- ovaries (18-29nt) S18 3rd inster #2SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S20 2-4day pupae#2SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 SRR032094 ago2 knockdown S16 KC -48 #1OSS8 Drosophila OSS cell small RNA libraries, rep4 GSM379054 Flam Heterozygote SRR014273 Ovary_rep1_Har_P OSS7 Drosophila OSS cell small RNA libraries, rep3 SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb S30 s2-48 #2SRR010955 Aub IP in Ago3 heterozygotes OSS6 Drosophila OSS cell small RNA libraries, rep2 SRR029028 untreated (mock) GSM379066 Zuc Mutant GSM180332 mid embryo (6-10) GSM379056 Krimp Heterozygote SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR014275 Ovary_rep1 LK_P OSS2 Drosophila OSS cell small RNA libraries, rep1 GSM379064 Vasa Mutant GSM379053 Aub Mutant GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown GSM280088 S2cell (AGO1IP) GSM379062 Squ Mutant V025 S2R+ cellGSM379061 Squ Heterozygote GSM343287 Drosophila Toll 10b mutant embryos V067 S2-NPS10 2-6h #1 (8)GSM280083 dcr-2-/- ovaries (18-29nt) GSM379067 SpnE Mutant GSM379058 GSM280086 WT ovaries (AGO2IP) S11 2-6h #2 (9)SRR014282 Ovary_rep1 wK_P GSM239051 S2 cells, beta-eliminated S14 0-1hr #1 (A)GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown S31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V020 S2R+ cellSRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells GSM379052 Aub Heterozygote GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM239050 fly heads, beta-eliminated SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars SRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P GSM180331 early embryo (2-6) SRR014277 Ovary_rep1 NA_P S8 S2-48,+48, KC-48, +48 mixGSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellS15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 GSM379051 Armi Mutant SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM280082 WT ovaries (18-29nt) SRR023399 RNA bound by P19 protein SRR029030 dcr-2 knockdown GSM424739 S2 parental SRR032093 ago1 knockdown SRR010951 Ago3 heterozygotes, oxidized GSM379057 Krimp Mutant SRR010953 Aub heterozygotes, oxidized
..................CGTCGCCAATCTCCAATGGCCACGTGTA..............................................................................................2811000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000
....................................GCCACGTGTATGCTCGTAGCTA..................................................................................2212000000000000000000000000000000000000000000000000000000000000000002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.....................................CCACGTGTATGCTCGTAGCTAT.................................................................................2212000000000000000000000000000002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000