Page generated on Fri Oct 15 12:01:54 2010

dme-mir-2280



dme-mir-2280

View dme-mir-2280 on miRBase

miRNA	Length	Perfect(sense)	Perfect(antisense)	5' moR	5'arm	Loop	3'arm	3' moR	Other	Loop Size	Mature	Star
dme-mir-2280	164	23			13		6	1	3	17	13	6

GGGAGCAAATGGAGAAGAGTGATATCGTTTAAGATGCTGTGAATATCCCGTTTTCTTAGCTTGGCAATAAAATATTATTCACAGAAACTAGTAATTTACTTCCAAGCTAACTGAAGGGGATATTCAGTGCAACCACGGACTAAAAATGCGTTTGGAAAAATTAC
........................((((....(.(((..((((((((((.(((..(((((((((...((((.((((((((...)))..))))).))))...)))))))))..))).))))))))))..))).).))))..........................-38.00
.....((((((.(....(((....((((....(.(((..((((((((((.(((..(((((((((...((((.((((((((...)))..))))).))))...)))))))))..))).))))))))))..))).).))))))).....).))))))..........-44.50
Sense strand

	Size	Blast	Total	OSS2 Drosophila OSS cell small RNA libraries, rep1	OSS6 Drosophila OSS cell small RNA libraries, rep2	OSS8 Drosophila OSS cell small RNA libraries, rep4	OSS7 Drosophila OSS cell small RNA libraries, rep3	S21 disk #2	SRR001347 ago2 untreated	SRR031697 Total small RNAs from dcr-2 heterozygous flies	SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies	S5 imaginal disc	SRR031701 Total small RNAs from r2d2 heterozygous flies	GSM280087 S2cell (AGO2IP)	GSM379067 SpnE Mutant	GSM379058	GSM280086 WT ovaries (AGO2IP)	S29 male head #1	V090 CS  male total RNA	S26 1st instar #2	SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1	V008 S2-DRSC	S11 2-6h #2 (9)	GSM180333 late embryo (12-24)	V018 Kc167 cell	S19 2-4day pupae #1	S24 male body #2	SRR014282 Ovary_rep1 wK_P	SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1	SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1	GSM239051 S2 cells, beta-eliminated	SRR029633 total small RNAs from hen1 homozygous flies	SRR032094 ago2 knockdown	S9 0-1h #3 (7)	SRR031699 Total small RNAs from dcr-2 homozygous flies	GSM180332 mid embryo (6-10)	S14 0-1hr #1 (A)	V002 IR+	SRR031692 Total small RNAs from Oregon R	V009 CMEL1	S16 KC -48 #1	SRR001341 WT_males non-beta-eliminated	V063 CS,ovary,AGO1IP	GSM180335 imaginal discs	V098 dcr-2[L811fsX] ovary	GSM180328 adult heads (female heads, male heads)	S4 female body	V019 GM2 cell	GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries	SRR029031 loqs-ORF knockdown	V088 r2d2[1] ovary total RNA	GSM379065 Zuc Heterozygote	S32 s2+48 #2	S7 12-24hr embryo	S31 s2+48 #1	SRR010957 Aub IP in Ago3 trans-heterozygotes	SRR031693_4	S13 6-10h #2 (11)	SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb	GSM379050 Armi Heterozygote	GSM379056 Krimp Heterozygote	SRR010952 Ago3 trans-heterozygotes, oxidized	GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day	SRR001337 WT_females beta-eliminated	V076 ML-DmBG3-C2	SRR023197 RNA Library from S2 control cells	SRR032092 mock oxidized	S23 female body #2	SRR029033 lacZ knockdown	SRR001349 heterozygous dcr-2_untreated	V010 MLDmD20c5	SRR010956 Piwi IP in Ago3 heterozygotes	GSM424740 S2 pKF63 stably transfected	SRR010954 Aub trans-heterozygotes, oxidized	SRR023400 total RNA extracted from P19 cells	V082 embryo 14-24hr	SRR001345 ago2 non-beta-eliminated	GSM379063 Vasa Heterozygote	V020 S2R+ cell	SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb	SRR023407 RNA bound by NLS-P19 protein	GSM180337 tissue culture cells (S2 only)	SRR010960 wt, oxidized	SRR023402 total RNA extracted from NLS-P19 cells	V066 r2d2[1], ovary, AGO1IP	SRR001340 IR beta-eliminated	GSM280084 loqs-/- ovaries (18-29nt)	SRR031703 Total small RNAs from r2d2 homozygous flies	GSM379054 Flam Heterozygote	S18 3rd inster #2	GSM379052 Aub Heterozygote	SRR014275 Ovary_rep1 LK_P	S34 KC+48 #1	V065 dcr-2[L811fsX], ovary, AGO1IP	SRR001343 dcr-2 non-beta-eliminated	GSM467731 loq	GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries	S1 male head	GSM467729 WT	SRR014273 Ovary_rep1_Har_P	V089 ago2[414] ovary total RNA	GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries	SRR001342 WT_males beta-eliminated	GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries	GSM379064 Vasa Mutant	S33 KC-48 #2	GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006)	GSM379053 Aub Mutant	SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies	GSM246084 D. melanogaster adult male heads 454	GSM239050 fly heads, beta-eliminated	SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies	GSM379055 Flam Mutant	SRR032095 AGO1 IP dcr2 knockdown	SRR029029 dcr-1 knockdown	GSM180334 larvae: 1st instar and 3rd instars	V028 CMEW1 Cl.8+ cell	GSM280088 S2cell (AGO1IP)	S3 male body	SRR010959 Ago3 IP in heterozygotes	SRR014280 Ovary_rep1 w1118_P	V026 1182-4H cell	GSM180331 early embryo (2-6)	V097 CS ovary	S25 1st instar #1	SRR029032 r2d2 knockdown	SRR014277 Ovary_rep1 NA_P	S8 S2-48,+48, KC-48, +48 mix	GSM180330 very early embryo (0-1)	GSM424741 S2 pKF63 transiently transfected	SRR032096 AGO2 IP dcr2 knockdown	V021 ML-DmD21 cell	SRR001344 dcr-2 beta-eliminated	S15 S2 -48 #1	GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0	SRR001339 WT_females non-beta-eliminated	SRR001348 ago2 oxidized	GSM379051 Armi Mutant	V075 ML-DmBG1-C1	SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb	SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies	SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb	S30 s2-48 #2	GSM379062 Squ Mutant	V011 Sg4	V025 S2R+ cell	S20 2-4day pupae#2	SRR031696_2152	SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb	SRR001664 homozygous dcr-2_untreated	GSM379061 Squ Heterozygote	SRR010958 Piwi IP in Ago3 trans-heterozygotes	SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1	GSM343287 Drosophila Toll 10b mutant embryos	V067 S2-NP	GSM280082 WT ovaries (18-29nt)	V001 IR-	S22 female head #1	SRR023399 RNA bound by P19 protein	SRR010955 Aub IP in Ago3 heterozygotes	GSM379060 SpnE Heterozygote	S27 0-1d Pupae (w)	V083 male, one day	SRR001338 IR non-beta-eliminated	SRR029030 dcr-2 knockdown	GSM239052 S2 cells, non beta-eliminated	GSM467730 r2d2	S28 0-2d pupae	S10 2-6h #1 (8)	GSM239041 fly heads, non beta-eliminated	GSM424739 S2 parental	S2 female head	GSM280083 dcr-2-/- ovaries (18-29nt)	GSM379059	SRR029028 untreated (mock)	SRR032093 ago1 knockdown	V024 kc167 cell	V033 CMEW1 Cl.8+ cell	GSM280085 WT testes (18-24nt)	GSM180329 adult bodies (female bodies, male bodies)	SRR001346 ago2 beta-eliminated	S12 6-10h #1 (10)	V084 female, one day	SRR010951 Ago3 heterozygotes, oxidized	S17 3rd inster #1	SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1	V081 embryo 2-6hr	GSM379057 Krimp Mutant	GSM379066 Zuc Mutant	SRR010953 Aub heterozygotes, oxidized	V064 ago2[414], ovary, AGO1IP	S35 KC+48 #2
............................................ATCCCGTTTTCTTAGCTTGGCAATA...............................................................................................	25	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
..............................................CCCGTTTTCTTAGCTTGGCAA.................................................................................................	21	1	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.....................................................TCTTAGCTTGGCAATAAAATATT........................................................................................	23	1	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.....................................................TCTTAGCTTGGCAATAAAAT...........................................................................................	20	1	2	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.....................................................TCTTAGCTTGGCAATAAAATATTA.......................................................................................	24	1	1	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.....................................................TCTTAGCTTGGCAATAAAA............................................................................................	19	1	2	0	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.....................................................TCTTAGCTTGGCAATAAAATAT.........................................................................................	22	1	7	4	1	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................................................................AATTTACTTCCAAGCTAACT....................................................	20	1	1	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................................................................AATTTACTTCCAAGCTAACTG...................................................	21	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................................................................AATTTACTTCCAAGCTAACTGA..................................................	22	1	4	2	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.................................................................................................ACTTCCAAGCTAACTGAAGGGGA............................................	23	1	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.......................................................................................................................ATATTCAGTGCAACCACGGACTAAAAA..................	27	1	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0

Antisense strand

	Size	Blast	Total	OSS2 Drosophila OSS cell small RNA libraries, rep1	OSS6 Drosophila OSS cell small RNA libraries, rep2	OSS8 Drosophila OSS cell small RNA libraries, rep4	OSS7 Drosophila OSS cell small RNA libraries, rep3	S21 disk #2	SRR001347 ago2 untreated	SRR031697 Total small RNAs from dcr-2 heterozygous flies	SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies	S5 imaginal disc	SRR031701 Total small RNAs from r2d2 heterozygous flies	GSM280087 S2cell (AGO2IP)	GSM379067 SpnE Mutant	GSM379058	GSM280086 WT ovaries (AGO2IP)	S29 male head #1	V090 CS  male total RNA	S26 1st instar #2	SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1	V008 S2-DRSC	S11 2-6h #2 (9)	GSM180333 late embryo (12-24)	V018 Kc167 cell	S19 2-4day pupae #1	S24 male body #2	SRR014282 Ovary_rep1 wK_P	SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1	SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1	GSM239051 S2 cells, beta-eliminated	SRR029633 total small RNAs from hen1 homozygous flies	SRR032094 ago2 knockdown	S9 0-1h #3 (7)	SRR031699 Total small RNAs from dcr-2 homozygous flies	GSM180332 mid embryo (6-10)	S14 0-1hr #1 (A)	V002 IR+	SRR031692 Total small RNAs from Oregon R	V009 CMEL1	S16 KC -48 #1	SRR001341 WT_males non-beta-eliminated	V063 CS,ovary,AGO1IP	GSM180335 imaginal discs	V098 dcr-2[L811fsX] ovary	GSM180328 adult heads (female heads, male heads)	S4 female body	V019 GM2 cell	GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries	SRR029031 loqs-ORF knockdown	V088 r2d2[1] ovary total RNA	GSM379065 Zuc Heterozygote	S32 s2+48 #2	S7 12-24hr embryo	S31 s2+48 #1	SRR010957 Aub IP in Ago3 trans-heterozygotes	SRR031693_4	S13 6-10h #2 (11)	SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb	GSM379050 Armi Heterozygote	GSM379056 Krimp Heterozygote	SRR010952 Ago3 trans-heterozygotes, oxidized	GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day	SRR001337 WT_females beta-eliminated	V076 ML-DmBG3-C2	SRR023197 RNA Library from S2 control cells	SRR032092 mock oxidized	S23 female body #2	SRR029033 lacZ knockdown	SRR001349 heterozygous dcr-2_untreated	V010 MLDmD20c5	SRR010956 Piwi IP in Ago3 heterozygotes	GSM424740 S2 pKF63 stably transfected	SRR010954 Aub trans-heterozygotes, oxidized	SRR023400 total RNA extracted from P19 cells	V082 embryo 14-24hr	SRR001345 ago2 non-beta-eliminated	GSM379063 Vasa Heterozygote	V020 S2R+ cell	SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb	SRR023407 RNA bound by NLS-P19 protein	GSM180337 tissue culture cells (S2 only)	SRR010960 wt, oxidized	SRR023402 total RNA extracted from NLS-P19 cells	V066 r2d2[1], ovary, AGO1IP	SRR001340 IR beta-eliminated	GSM280084 loqs-/- ovaries (18-29nt)	SRR031703 Total small RNAs from r2d2 homozygous flies	GSM379054 Flam Heterozygote	S18 3rd inster #2	GSM379052 Aub Heterozygote	SRR014275 Ovary_rep1 LK_P	S34 KC+48 #1	V065 dcr-2[L811fsX], ovary, AGO1IP	SRR001343 dcr-2 non-beta-eliminated	GSM467731 loq	GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries	S1 male head	GSM467729 WT	SRR014273 Ovary_rep1_Har_P	V089 ago2[414] ovary total RNA	GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries	SRR001342 WT_males beta-eliminated	GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries	GSM379064 Vasa Mutant	S33 KC-48 #2	GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006)	GSM379053 Aub Mutant	SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies	GSM246084 D. melanogaster adult male heads 454	GSM239050 fly heads, beta-eliminated	SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies	GSM379055 Flam Mutant	SRR032095 AGO1 IP dcr2 knockdown	SRR029029 dcr-1 knockdown	GSM180334 larvae: 1st instar and 3rd instars	V028 CMEW1 Cl.8+ cell	GSM280088 S2cell (AGO1IP)	S3 male body	SRR010959 Ago3 IP in heterozygotes	SRR014280 Ovary_rep1 w1118_P	V026 1182-4H cell	GSM180331 early embryo (2-6)	V097 CS ovary	S25 1st instar #1	SRR029032 r2d2 knockdown	SRR014277 Ovary_rep1 NA_P	S8 S2-48,+48, KC-48, +48 mix	GSM180330 very early embryo (0-1)	GSM424741 S2 pKF63 transiently transfected	SRR032096 AGO2 IP dcr2 knockdown	V021 ML-DmD21 cell	SRR001344 dcr-2 beta-eliminated	S15 S2 -48 #1	GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0	SRR001339 WT_females non-beta-eliminated	SRR001348 ago2 oxidized	GSM379051 Armi Mutant	V075 ML-DmBG1-C1	SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb	SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies	SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb	S30 s2-48 #2	GSM379062 Squ Mutant	V011 Sg4	V025 S2R+ cell	S20 2-4day pupae#2	SRR031696_2152	SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb	SRR001664 homozygous dcr-2_untreated	GSM379061 Squ Heterozygote	SRR010958 Piwi IP in Ago3 trans-heterozygotes	SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1	GSM343287 Drosophila Toll 10b mutant embryos	V067 S2-NP	GSM280082 WT ovaries (18-29nt)	V001 IR-	S22 female head #1	SRR023399 RNA bound by P19 protein	SRR010955 Aub IP in Ago3 heterozygotes	GSM379060 SpnE Heterozygote	S27 0-1d Pupae (w)	V083 male, one day	SRR001338 IR non-beta-eliminated	SRR029030 dcr-2 knockdown	GSM239052 S2 cells, non beta-eliminated	GSM467730 r2d2	S28 0-2d pupae	S10 2-6h #1 (8)	GSM239041 fly heads, non beta-eliminated	GSM424739 S2 parental	S2 female head	GSM280083 dcr-2-/- ovaries (18-29nt)	GSM379059	SRR029028 untreated (mock)	SRR032093 ago1 knockdown	V024 kc167 cell	V033 CMEW1 Cl.8+ cell	GSM280085 WT testes (18-24nt)	GSM180329 adult bodies (female bodies, male bodies)	SRR001346 ago2 beta-eliminated	S12 6-10h #1 (10)	V084 female, one day	SRR010951 Ago3 heterozygotes, oxidized	S17 3rd inster #1	SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1	V081 embryo 2-6hr	GSM379057 Krimp Mutant	GSM379066 Zuc Mutant	SRR010953 Aub heterozygotes, oxidized	V064 ago2[414], ovary, AGO1IP	S35 KC+48 #2