Page generated on Fri Oct 15 12:01:54 2010

dme-mir-2281




dme-mir-2281

View dme-mir-2281 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-22811521716751776


TTCCAGGCATCCAGTGCATCCTACGGATGTCGAGCAGTACACGTATTATCTGCAGCTGCAGATGCAAATGTATATGTATCTGTATCTGTATCTGCAGTATTGCAGTATCGCTGCTTTATTCATATCCATGAGACGCGTCGCGACATGTGTAA
........................((((((.(((((((..(((((.((.((((((.((((((((((.(((......))).)))))))))).)))))))).))).))...))))))).....)))))).........................-39.30
.....(((((((.(((.....))))))))))......(((((((.....(((((((((((((((((...(((((......))))).))))))))))))..)))))..((((.((....(((((....)))))....)).)))).))))))).-51.60
Sense strand
                                                                                                                                                        SizeBlastTotalOSS8 Drosophila OSS cell small RNA libraries, rep4 OSS2 Drosophila OSS cell small RNA libraries, rep1 OSS7 Drosophila OSS cell small RNA libraries, rep3 OSS6 Drosophila OSS cell small RNA libraries, rep2 SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 V076 ML-DmBG3-C2S33 KC-48 #2SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies V075 ML-DmBG1-C1S35 KC+48 #2GSM280087 S2cell (AGO2IP) GSM379067 SpnE Mutant GSM379058 GSM280086 WT ovaries (AGO2IP) SRR001347 ago2 untreated S29 male head #1V090 CS  male total RNA  S26 1st instar #2V008 S2-DRSCS11 2-6h #2 (9)GSM180333 late embryo (12-24) V018 Kc167 cellS19 2-4day pupae #1S24 male body #2SRR014282 Ovary_rep1 wK_P SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM239051 S2 cells, beta-eliminated SRR029633 total small RNAs from hen1 homozygous flies SRR032094 ago2 knockdown S9 0-1h #3 (7)SRR031699 Total small RNAs from dcr-2 homozygous flies GSM180332 mid embryo (6-10) S14 0-1hr #1 (A)V002 IR+SRR031692 Total small RNAs from Oregon R V009 CMEL1S16 KC -48 #1SRR001341 WT_males non-beta-eliminated V063 CS,ovary,AGO1IPGSM180335 imaginal discs V098 dcr-2[L811fsX] ovaryGSM180328 adult heads (female heads, male heads) S4 female bodyV019 GM2 cellGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown V088 r2d2[1] ovary total RNA  GSM379065 Zuc Heterozygote S32 s2+48 #2S7 12-24hr embryoS31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes SRR031693_4 S13 6-10h #2 (11)SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote GSM379056 Krimp Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized S23 female body #2SRR029033 lacZ knockdown SRR001349 heterozygous dcr-2_untreated V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V082 embryo 14-24hrSRR001345 ago2 non-beta-eliminated GSM379063 Vasa Heterozygote V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells V066 r2d2[1], ovary, AGO1IPSRR001340 IR beta-eliminated GSM280084 loqs-/- ovaries (18-29nt) SRR031703 Total small RNAs from r2d2 homozygous flies GSM379054 Flam Heterozygote S18 3rd inster #2GSM379052 Aub Heterozygote SRR014275 Ovary_rep1 LK_P S34 KC+48 #1V065 dcr-2[L811fsX], ovary, AGO1IPSRR001343 dcr-2 non-beta-eliminated GSM467731 loq GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries S1 male headGSM467729 WT SRR014273 Ovary_rep1_Har_P V089 ago2[414] ovary total RNA  GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR031697 Total small RNAs from dcr-2 heterozygous flies SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM379064 Vasa Mutant GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars V028 CMEW1 Cl.8+ cellGSM280088 S2cell (AGO1IP) S3 male bodySRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P V026 1182-4H cellGSM180331 early embryo (2-6) V097 CS ovaryS25 1st instar #1SRR029032 r2d2 knockdown SRR014277 Ovary_rep1 NA_P S8 S2-48,+48, KC-48, +48 mixGSM180330 very early embryo (0-1) S5 imaginal discGSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated S15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized S21 disk #2GSM379051 Armi Mutant SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S30 s2-48 #2GSM379062 Squ Mutant V011 Sg4V025 S2R+ cellS20 2-4day pupae#2SRR031696_2152 SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR001664 homozygous dcr-2_untreated GSM379061 Squ Heterozygote SRR010958 Piwi IP in Ago3 trans-heterozygotes SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM343287 Drosophila Toll 10b mutant embryos V067 S2-NPGSM280082 WT ovaries (18-29nt) V001 IR-S22 female head #1SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes GSM379060 SpnE Heterozygote S27 0-1d Pupae (w)V083 male, one daySRR001338 IR non-beta-eliminated SRR031701 Total small RNAs from r2d2 heterozygous flies SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 S28 0-2d pupaeS10 2-6h #1 (8)GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental S2 female headGSM280083 dcr-2-/- ovaries (18-29nt) GSM379059 SRR029028 untreated (mock) SRR032093 ago1 knockdown V024 kc167 cellV033 CMEW1 Cl.8+ cellGSM280085 WT testes (18-24nt) GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated S12 6-10h #1 (10)V084 female, one daySRR010951 Ago3 heterozygotes, oxidized S17 3rd inster #1SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V081 embryo 2-6hrGSM379057 Krimp Mutant GSM379066 Zuc Mutant SRR010953 Aub heterozygotes, oxidized V064 ago2[414], ovary, AGO1IP
...........................................TATTATCTGCAGCTGCAGATGCA......................................................................................2311100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................ATTATCTGCAGCTGCAGATGCA......................................................................................2211100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................ATTATCTGCAGCTGCAGATGCAA.....................................................................................2311000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................ATTATCTGCAGCTGCAGATGC.......................................................................................2112110000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................TTATCTGCAGCTGCAGATGC.......................................................................................2011001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.....................................................................GTATATGTATCTGTATCTGTA..............................................................21121000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................................................TATGTATCTGTATCTGTATCT...........................................................21191000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................................................TGTATCTGTATCTGTATCTGC.........................................................21412000000100100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................................TATCTGTATCTGCAGTATTG..................................................2014110101000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................................TATCTGTATCTGCAGTATTGC.................................................2113012000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                                                        SizeBlastTotalOSS8 Drosophila OSS cell small RNA libraries, rep4 OSS2 Drosophila OSS cell small RNA libraries, rep1 OSS7 Drosophila OSS cell small RNA libraries, rep3 OSS6 Drosophila OSS cell small RNA libraries, rep2 SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 V076 ML-DmBG3-C2S33 KC-48 #2SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies V075 ML-DmBG1-C1S35 KC+48 #2GSM280087 S2cell (AGO2IP) GSM379067 SpnE Mutant GSM379058 GSM280086 WT ovaries (AGO2IP) SRR001347 ago2 untreated S29 male head #1V090 CS  male total RNA  S26 1st instar #2V008 S2-DRSCS11 2-6h #2 (9)GSM180333 late embryo (12-24) V018 Kc167 cellS19 2-4day pupae #1S24 male body #2SRR014282 Ovary_rep1 wK_P SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM239051 S2 cells, beta-eliminated SRR029633 total small RNAs from hen1 homozygous flies SRR032094 ago2 knockdown S9 0-1h #3 (7)SRR031699 Total small RNAs from dcr-2 homozygous flies GSM180332 mid embryo (6-10) S14 0-1hr #1 (A)V002 IR+SRR031692 Total small RNAs from Oregon R V009 CMEL1S16 KC -48 #1SRR001341 WT_males non-beta-eliminated V063 CS,ovary,AGO1IPGSM180335 imaginal discs V098 dcr-2[L811fsX] ovaryGSM180328 adult heads (female heads, male heads) S4 female bodyV019 GM2 cellGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown V088 r2d2[1] ovary total RNA  GSM379065 Zuc Heterozygote S32 s2+48 #2S7 12-24hr embryoS31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes SRR031693_4 S13 6-10h #2 (11)SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote GSM379056 Krimp Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized S23 female body #2SRR029033 lacZ knockdown SRR001349 heterozygous dcr-2_untreated V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V082 embryo 14-24hrSRR001345 ago2 non-beta-eliminated GSM379063 Vasa Heterozygote V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells V066 r2d2[1], ovary, AGO1IPSRR001340 IR beta-eliminated GSM280084 loqs-/- ovaries (18-29nt) SRR031703 Total small RNAs from r2d2 homozygous flies GSM379054 Flam Heterozygote S18 3rd inster #2GSM379052 Aub Heterozygote SRR014275 Ovary_rep1 LK_P S34 KC+48 #1V065 dcr-2[L811fsX], ovary, AGO1IPSRR001343 dcr-2 non-beta-eliminated GSM467731 loq GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries S1 male headGSM467729 WT SRR014273 Ovary_rep1_Har_P V089 ago2[414] ovary total RNA  GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR031697 Total small RNAs from dcr-2 heterozygous flies SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM379064 Vasa Mutant GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars V028 CMEW1 Cl.8+ cellGSM280088 S2cell (AGO1IP) S3 male bodySRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P V026 1182-4H cellGSM180331 early embryo (2-6) V097 CS ovaryS25 1st instar #1SRR029032 r2d2 knockdown SRR014277 Ovary_rep1 NA_P S8 S2-48,+48, KC-48, +48 mixGSM180330 very early embryo (0-1) S5 imaginal discGSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated S15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized S21 disk #2GSM379051 Armi Mutant SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S30 s2-48 #2GSM379062 Squ Mutant V011 Sg4V025 S2R+ cellS20 2-4day pupae#2SRR031696_2152 SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR001664 homozygous dcr-2_untreated GSM379061 Squ Heterozygote SRR010958 Piwi IP in Ago3 trans-heterozygotes SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM343287 Drosophila Toll 10b mutant embryos V067 S2-NPGSM280082 WT ovaries (18-29nt) V001 IR-S22 female head #1SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes GSM379060 SpnE Heterozygote S27 0-1d Pupae (w)V083 male, one daySRR001338 IR non-beta-eliminated SRR031701 Total small RNAs from r2d2 heterozygous flies SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 S28 0-2d pupaeS10 2-6h #1 (8)GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental S2 female headGSM280083 dcr-2-/- ovaries (18-29nt) GSM379059 SRR029028 untreated (mock) SRR032093 ago1 knockdown V024 kc167 cellV033 CMEW1 Cl.8+ cellGSM280085 WT testes (18-24nt) GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated S12 6-10h #1 (10)V084 female, one daySRR010951 Ago3 heterozygotes, oxidized S17 3rd inster #1SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V081 embryo 2-6hrGSM379057 Krimp Mutant GSM379066 Zuc Mutant SRR010953 Aub heterozygotes, oxidized V064 ago2[414], ovary, AGO1IP
...........................................................................GTATCTGTATCTGTATCTGCA........................................................21241000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000