Page generated on Fri Oct 15 12:01:53 2010

dme-mir-2491



dme-mir-2491

View dme-mir-2491 on miRBase

miRNA	Length	Perfect(sense)	Perfect(antisense)	5' moR	5'arm	Loop	3'arm	3' moR	Other	Loop Size	Mature	Star
dme-mir-2491	193	129	35	3	63	3	62	1	32	64	62	63

GCAATAAAAACTAAATGACACCACCGCGAACCACTTTGTGCCGCTGTTGCCTTTGCAGTTGCTGTTTTCCATGTTGCTACTGCGGCCAATTGTTGCGCATCAGCAACATCAACAACATCAACAACAGCAGCAGCAACTGCAGTAGCAGCACTCGTGATTCACTTTCGACTCAATTCGTCGCTACGTTTCAGTT
...........................(((.(((...((((.((((((((..((((.(((((((((......(((((....)))))....((((((......))))))..............))))))))).))))..)))))))).))))..))).))).................................-53.00
........(((((((((..........(((.(((...((((.((((((((..((((.(((((((((......(((((....)))))....((((((......))))))..............))))))))).))))..)))))))).))))..))).))).....((((.......))))...))))).))))-60.10
Sense strand

	Size	Blast	Total	V018 Kc167 cell	S33 KC-48 #2	V020 S2R+ cell	V021 ML-DmD21 cell	V097 CS ovary	V098 dcr-2[L811fsX] ovary	S10 2-6h #1 (8)	V025 S2R+ cell	V081 embryo 2-6hr	S13 6-10h #2 (11)	SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1	S16 KC -48 #1	V082 embryo 14-24hr	SRR029032 r2d2 knockdown	V024 kc167 cell	S9 0-1h #3 (7)	SRR031692 Total small RNAs from Oregon R	S34 KC+48 #1	GSM467731 loq	GSM467729 WT	SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1	S35 KC+48 #2	S26 1st instar #2	SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1	V008 S2-DRSC	S19 2-4day pupae #1	SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1	SRR029633 total small RNAs from hen1 homozygous flies	GSM180332 mid embryo (6-10)	V009 CMEL1	OSS8 Drosophila OSS cell small RNA libraries, rep4	GSM379065 Zuc Heterozygote	S32 s2+48 #2	S31 s2+48 #1	SRR031693_4	V076 ML-DmBG3-C2	V010 MLDmD20c5	GSM379063 Vasa Heterozygote	SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb	SRR014273 Ovary_rep1_Har_P	SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies	SRR014280 Ovary_rep1 w1118_P	S8 S2-48,+48, KC-48, +48 mix	SRR032096 AGO2 IP dcr2 knockdown	S15 S2 -48 #1	GSM379051 Armi Mutant	S30 s2-48 #2	SRR001664 homozygous dcr-2_untreated	V067 S2-NP	GSM280082 WT ovaries (18-29nt)	S22 female head #1	S27 0-1d Pupae (w)	GSM467730 r2d2	S17 3rd inster #1	GSM280087 S2cell (AGO2IP)	GSM379067 SpnE Mutant	GSM379058	GSM280086 WT ovaries (AGO2IP)	SRR001347 ago2 untreated	S29 male head #1	V090 CS  male total RNA	S11 2-6h #2 (9)	GSM180333 late embryo (12-24)	S24 male body #2	SRR014282 Ovary_rep1 wK_P	GSM239051 S2 cells, beta-eliminated	SRR032094 ago2 knockdown	SRR031699 Total small RNAs from dcr-2 homozygous flies	S14 0-1hr #1 (A)	V002 IR+	SRR001341 WT_males non-beta-eliminated	V063 CS,ovary,AGO1IP	GSM180335 imaginal discs	GSM180328 adult heads (female heads, male heads)	S4 female body	V019 GM2 cell	GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries	SRR029031 loqs-ORF knockdown	V088 r2d2[1] ovary total RNA	S7 12-24hr embryo	SRR010957 Aub IP in Ago3 trans-heterozygotes	SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb	GSM379050 Armi Heterozygote	GSM379056 Krimp Heterozygote	SRR010952 Ago3 trans-heterozygotes, oxidized	GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day	SRR001337 WT_females beta-eliminated	SRR023197 RNA Library from S2 control cells	SRR032092 mock oxidized	S23 female body #2	SRR029033 lacZ knockdown	SRR001349 heterozygous dcr-2_untreated	SRR010956 Piwi IP in Ago3 heterozygotes	GSM424740 S2 pKF63 stably transfected	SRR010954 Aub trans-heterozygotes, oxidized	SRR023400 total RNA extracted from P19 cells	SRR001345 ago2 non-beta-eliminated	SRR023407 RNA bound by NLS-P19 protein	GSM180337 tissue culture cells (S2 only)	SRR010960 wt, oxidized	SRR023402 total RNA extracted from NLS-P19 cells	V066 r2d2[1], ovary, AGO1IP	SRR001340 IR beta-eliminated	GSM280084 loqs-/- ovaries (18-29nt)	SRR031703 Total small RNAs from r2d2 homozygous flies	GSM379054 Flam Heterozygote	S18 3rd inster #2	GSM379052 Aub Heterozygote	SRR014275 Ovary_rep1 LK_P	V065 dcr-2[L811fsX], ovary, AGO1IP	OSS2 Drosophila OSS cell small RNA libraries, rep1	SRR001343 dcr-2 non-beta-eliminated	GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries	S1 male head	V089 ago2[414] ovary total RNA	GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries	SRR031697 Total small RNAs from dcr-2 heterozygous flies	SRR001342 WT_males beta-eliminated	GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries	GSM379064 Vasa Mutant	GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006)	GSM379053 Aub Mutant	GSM246084 D. melanogaster adult male heads 454	GSM239050 fly heads, beta-eliminated	SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies	GSM379055 Flam Mutant	SRR032095 AGO1 IP dcr2 knockdown	SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies	SRR029029 dcr-1 knockdown	GSM180334 larvae: 1st instar and 3rd instars	V028 CMEW1 Cl.8+ cell	GSM280088 S2cell (AGO1IP)	S3 male body	SRR010959 Ago3 IP in heterozygotes	V026 1182-4H cell	GSM180331 early embryo (2-6)	S25 1st instar #1	SRR014277 Ovary_rep1 NA_P	OSS7 Drosophila OSS cell small RNA libraries, rep3	GSM180330 very early embryo (0-1)	S5 imaginal disc	GSM424741 S2 pKF63 transiently transfected	SRR001344 dcr-2 beta-eliminated	GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0	SRR001339 WT_females non-beta-eliminated	SRR001348 ago2 oxidized	S21 disk #2	V075 ML-DmBG1-C1	SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb	SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies	SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb	GSM379062 Squ Mutant	V011 Sg4	S20 2-4day pupae#2	SRR031696_2152	SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb	GSM379061 Squ Heterozygote	SRR010958 Piwi IP in Ago3 trans-heterozygotes	SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1	GSM343287 Drosophila Toll 10b mutant embryos	V001 IR-	SRR023399 RNA bound by P19 protein	SRR010955 Aub IP in Ago3 heterozygotes	GSM379060 SpnE Heterozygote	V083 male, one day	SRR001338 IR non-beta-eliminated	SRR031701 Total small RNAs from r2d2 heterozygous flies	SRR029030 dcr-2 knockdown	GSM239052 S2 cells, non beta-eliminated	S28 0-2d pupae	GSM239041 fly heads, non beta-eliminated	GSM424739 S2 parental	OSS6 Drosophila OSS cell small RNA libraries, rep2	S2 female head	GSM280083 dcr-2-/- ovaries (18-29nt)	GSM379059	SRR029028 untreated (mock)	SRR032093 ago1 knockdown	V033 CMEW1 Cl.8+ cell	GSM280085 WT testes (18-24nt)	GSM180329 adult bodies (female bodies, male bodies)	SRR001346 ago2 beta-eliminated	S12 6-10h #1 (10)	V084 female, one day	SRR010951 Ago3 heterozygotes, oxidized	GSM379057 Krimp Mutant	GSM379066 Zuc Mutant	SRR010953 Aub heterozygotes, oxidized	V064 ago2[414], ovary, AGO1IP
....................CCACCGCGAACCACTTTGTGC........................................................................................................................................................	21	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................ACCGCGAACCACTTTGTGC........................................................................................................................................................	19	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.......................CCGCGAACCACTTTGTGCCG......................................................................................................................................................	20	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.........................................CGCTGTTGCCTTTGCAGT......................................................................................................................................	18	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.........................................CGCTGTTGCCTTTGCAGTTGCT..................................................................................................................................	22	1	26	0	4	0	0	0	0	8	0	0	4	0	2	0	0	0	2	1	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.........................................CGCTGTTGCCTTTGCAGTTGC...................................................................................................................................	21	1	4	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.........................................CGCTGTTGCCTTTGCAGTTG....................................................................................................................................	20	1	16	0	9	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.........................................CGCTGTTGCCTTTGCAGTT.....................................................................................................................................	19	1	3	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
..........................................GCTGTTGCCTTTGCAGTTGC...................................................................................................................................	20	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................TGTTGCCTTTGCAGTTGCTGT................................................................................................................................	21	1	5	0	0	0	2	0	0	0	0	0	0	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................TGTTGCCTTTGCAGTTGCTGTT...............................................................................................................................	22	1	6	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.................................................................................GCGGCCAATTGTTGCGCATC............................................................................................	20	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................................................CAACAACAGCAGCAGCAA.........................................................	18	136	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................................................CAACAACAGCAGCAGCAAC........................................................	19	122	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
..............................................................................................................................GCAGCAGCAACTGCAGTAGCAG.............................................	22	1	1	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
...............................................................................................................................CAGCAGCAACTGCAGTAGCAGC............................................	22	1	58	19	0	11	9	0	0	0	5	1	0	1	0	2	3	2	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	1	0	0	0	0	0	1	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
...............................................................................................................................CAGCAGCAACTGCAGTAGCAG.............................................	21	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.................................................................................................................................GCAGCAACTGCAGTAGCAGC............................................	20	2	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0

Antisense strand

	Size	Blast	Total	V018 Kc167 cell	S33 KC-48 #2	V020 S2R+ cell	V021 ML-DmD21 cell	V097 CS ovary	V098 dcr-2[L811fsX] ovary	S10 2-6h #1 (8)	V025 S2R+ cell	V081 embryo 2-6hr	S13 6-10h #2 (11)	SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1	S16 KC -48 #1	V082 embryo 14-24hr	SRR029032 r2d2 knockdown	V024 kc167 cell	S9 0-1h #3 (7)	SRR031692 Total small RNAs from Oregon R	S34 KC+48 #1	GSM467731 loq	GSM467729 WT	SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1	S35 KC+48 #2	S26 1st instar #2	SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1	V008 S2-DRSC	S19 2-4day pupae #1	SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1	SRR029633 total small RNAs from hen1 homozygous flies	GSM180332 mid embryo (6-10)	V009 CMEL1	OSS8 Drosophila OSS cell small RNA libraries, rep4	GSM379065 Zuc Heterozygote	S32 s2+48 #2	S31 s2+48 #1	SRR031693_4	V076 ML-DmBG3-C2	V010 MLDmD20c5	GSM379063 Vasa Heterozygote	SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb	SRR014273 Ovary_rep1_Har_P	SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies	SRR014280 Ovary_rep1 w1118_P	S8 S2-48,+48, KC-48, +48 mix	SRR032096 AGO2 IP dcr2 knockdown	S15 S2 -48 #1	GSM379051 Armi Mutant	S30 s2-48 #2	SRR001664 homozygous dcr-2_untreated	V067 S2-NP	GSM280082 WT ovaries (18-29nt)	S22 female head #1	S27 0-1d Pupae (w)	GSM467730 r2d2	S17 3rd inster #1	GSM280087 S2cell (AGO2IP)	GSM379067 SpnE Mutant	GSM379058	GSM280086 WT ovaries (AGO2IP)	SRR001347 ago2 untreated	S29 male head #1	V090 CS  male total RNA	S11 2-6h #2 (9)	GSM180333 late embryo (12-24)	S24 male body #2	SRR014282 Ovary_rep1 wK_P	GSM239051 S2 cells, beta-eliminated	SRR032094 ago2 knockdown	SRR031699 Total small RNAs from dcr-2 homozygous flies	S14 0-1hr #1 (A)	V002 IR+	SRR001341 WT_males non-beta-eliminated	V063 CS,ovary,AGO1IP	GSM180335 imaginal discs	GSM180328 adult heads (female heads, male heads)	S4 female body	V019 GM2 cell	GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries	SRR029031 loqs-ORF knockdown	V088 r2d2[1] ovary total RNA	S7 12-24hr embryo	SRR010957 Aub IP in Ago3 trans-heterozygotes	SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb	GSM379050 Armi Heterozygote	GSM379056 Krimp Heterozygote	SRR010952 Ago3 trans-heterozygotes, oxidized	GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day	SRR001337 WT_females beta-eliminated	SRR023197 RNA Library from S2 control cells	SRR032092 mock oxidized	S23 female body #2	SRR029033 lacZ knockdown	SRR001349 heterozygous dcr-2_untreated	SRR010956 Piwi IP in Ago3 heterozygotes	GSM424740 S2 pKF63 stably transfected	SRR010954 Aub trans-heterozygotes, oxidized	SRR023400 total RNA extracted from P19 cells	SRR001345 ago2 non-beta-eliminated	SRR023407 RNA bound by NLS-P19 protein	GSM180337 tissue culture cells (S2 only)	SRR010960 wt, oxidized	SRR023402 total RNA extracted from NLS-P19 cells	V066 r2d2[1], ovary, AGO1IP	SRR001340 IR beta-eliminated	GSM280084 loqs-/- ovaries (18-29nt)	SRR031703 Total small RNAs from r2d2 homozygous flies	GSM379054 Flam Heterozygote	S18 3rd inster #2	GSM379052 Aub Heterozygote	SRR014275 Ovary_rep1 LK_P	V065 dcr-2[L811fsX], ovary, AGO1IP	OSS2 Drosophila OSS cell small RNA libraries, rep1	SRR001343 dcr-2 non-beta-eliminated	GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries	S1 male head	V089 ago2[414] ovary total RNA	GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries	SRR031697 Total small RNAs from dcr-2 heterozygous flies	SRR001342 WT_males beta-eliminated	GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries	GSM379064 Vasa Mutant	GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006)	GSM379053 Aub Mutant	GSM246084 D. melanogaster adult male heads 454	GSM239050 fly heads, beta-eliminated	SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies	GSM379055 Flam Mutant	SRR032095 AGO1 IP dcr2 knockdown	SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies	SRR029029 dcr-1 knockdown	GSM180334 larvae: 1st instar and 3rd instars	V028 CMEW1 Cl.8+ cell	GSM280088 S2cell (AGO1IP)	S3 male body	SRR010959 Ago3 IP in heterozygotes	V026 1182-4H cell	GSM180331 early embryo (2-6)	S25 1st instar #1	SRR014277 Ovary_rep1 NA_P	OSS7 Drosophila OSS cell small RNA libraries, rep3	GSM180330 very early embryo (0-1)	S5 imaginal disc	GSM424741 S2 pKF63 transiently transfected	SRR001344 dcr-2 beta-eliminated	GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0	SRR001339 WT_females non-beta-eliminated	SRR001348 ago2 oxidized	S21 disk #2	V075 ML-DmBG1-C1	SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb	SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies	SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb	GSM379062 Squ Mutant	V011 Sg4	S20 2-4day pupae#2	SRR031696_2152	SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb	GSM379061 Squ Heterozygote	SRR010958 Piwi IP in Ago3 trans-heterozygotes	SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1	GSM343287 Drosophila Toll 10b mutant embryos	V001 IR-	SRR023399 RNA bound by P19 protein	SRR010955 Aub IP in Ago3 heterozygotes	GSM379060 SpnE Heterozygote	V083 male, one day	SRR001338 IR non-beta-eliminated	SRR031701 Total small RNAs from r2d2 heterozygous flies	SRR029030 dcr-2 knockdown	GSM239052 S2 cells, non beta-eliminated	S28 0-2d pupae	GSM239041 fly heads, non beta-eliminated	GSM424739 S2 parental	OSS6 Drosophila OSS cell small RNA libraries, rep2	S2 female head	GSM280083 dcr-2-/- ovaries (18-29nt)	GSM379059	SRR029028 untreated (mock)	SRR032093 ago1 knockdown	V033 CMEW1 Cl.8+ cell	GSM280085 WT testes (18-24nt)	GSM180329 adult bodies (female bodies, male bodies)	SRR001346 ago2 beta-eliminated	S12 6-10h #1 (10)	V084 female, one day	SRR010951 Ago3 heterozygotes, oxidized	GSM379057 Krimp Mutant	GSM379066 Zuc Mutant	SRR010953 Aub heterozygotes, oxidized	V064 ago2[414], ovary, AGO1IP
............................AACCACTTTGTGCCGCTG...................................................................................................................................................	18	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
..............................................TTGCCTTTGCAGTTGCTGT................................................................................................................................	19	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.........................................................GTTGCTGTTTTCCATGTTGCTACTGCG.............................................................................................................	27	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................................GCTGTTTTCCATGTTGCTACTGCGGCCA.........................................................................................................	28	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
..........................................................................................TGTTGCGCATCAGCAACATCAACAACATCA.........................................................................	30	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.....................................................................................................................TCAACAACAGCAGCAGCA..........................................................	18	10	2	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................................................CAACAACAGCAGCAGCAA.........................................................	18	136	15	0	0	0	0	5	7	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................................................CAACAACAGCAGCAGCAAC........................................................	19	122	11	0	0	0	0	5	2	0	0	3	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
...........................................................................................................................ACAGCAGCAGCAACTGCAGTA.................................................	21	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
...................................................................................................................................................GCACTCGTGATTCACTTTCGACTCAA....................	26	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0