Page generated on Fri Oct 15 12:01:52 2010

dme-mir-2497




dme-mir-2497

View dme-mir-2497 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-24971456032325243385322252338


TTCTCCATGGAGACATCCGGGATAAGCACGTCATCGTAAGCATTGCAAAATGTAGTTGTTAAATTCGCTCTTCAATCATTAACAACATTTACAATGTTTGCAGGCTGTCAACGTTGATGGCCAGTTGCGATGGTTCCAGTCAATA
.........................((.(((((.(((.(((.(((((((.((((((((((((................))))))))...))))...))))))))))....))).)))))))........................-26.69
.((((....)))).....(((((..(((.......((((((((((..((((((.((((.....................)))).)))))).)))))))))).((((((((....))))))))...)))....)))))........-41.10
Sense strand
                                                                                                                                                 SizeBlastTotalS33 KC-48 #2SRR031703 Total small RNAs from r2d2 homozygous flies V028 CMEW1 Cl.8+ cellV033 CMEW1 Cl.8+ cellS32 s2+48 #2V081 embryo 2-6hrSRR031696_2152 SRR031692 Total small RNAs from Oregon R S16 KC -48 #1SRR031701 Total small RNAs from r2d2 heterozygous flies V076 ML-DmBG3-C2SRR031697 Total small RNAs from dcr-2 heterozygous flies S30 s2-48 #2S29 male head #1S35 KC+48 #2V088 r2d2[1] ovary total RNA  V024 kc167 cellS12 6-10h #1 (10)SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR029030 dcr-2 knockdown V018 Kc167 cellV010 MLDmD20c5V067 S2-NPOSS6 Drosophila OSS cell small RNA libraries, rep2 SRR029633 total small RNAs from hen1 homozygous flies OSS8 Drosophila OSS cell small RNA libraries, rep4 S31 s2+48 #1V082 embryo 14-24hrOSS2 Drosophila OSS cell small RNA libraries, rep1 SRR032094 ago2 knockdown V009 CMEL1V008 S2-DRSCS9 0-1h #3 (7)V019 GM2 cellS13 6-10h #2 (11)GSM467729 WT V089 ago2[414] ovary total RNA  V026 1182-4H cellV097 CS ovaryOSS7 Drosophila OSS cell small RNA libraries, rep3 V025 S2R+ cellS28 0-2d pupaeSRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 SRR001347 ago2 untreated S14 0-1hr #1 (A)GSM379056 Krimp Heterozygote V020 S2R+ cellGSM379064 Vasa Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies S15 S2 -48 #1S22 female head #1GSM379057 Krimp Mutant V090 CS  male total RNA  SRR001349 heterozygous dcr-2_untreated V066 r2d2[1], ovary, AGO1IPSRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR029032 r2d2 knockdown S8 S2-48,+48, KC-48, +48 mixSRR001348 ago2 oxidized V075 ML-DmBG1-C1SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies S27 0-1d Pupae (w)S2 female headGSM379066 Zuc Mutant V064 ago2[414], ovary, AGO1IPGSM379067 SpnE Mutant SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR031699 Total small RNAs from dcr-2 homozygous flies V002 IR+SRR001341 WT_males non-beta-eliminated V063 CS,ovary,AGO1IPS4 female bodySRR010952 Ago3 trans-heterozygotes, oxidized S23 female body #2SRR010956 Piwi IP in Ago3 heterozygotes SRR010954 Aub trans-heterozygotes, oxidized SRR001345 ago2 non-beta-eliminated GSM180337 tissue culture cells (S2 only) SRR014275 Ovary_rep1 LK_P S34 KC+48 #1GSM467731 loq SRR014273 Ovary_rep1_Har_P SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies GSM280088 S2cell (AGO1IP) S25 1st instar #1V021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated SRR001339 WT_females non-beta-eliminated GSM379051 Armi Mutant SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb GSM379062 Squ Mutant V011 Sg4SRR001664 homozygous dcr-2_untreated SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM280082 WT ovaries (18-29nt) GSM379060 SpnE Heterozygote V083 male, one dayGSM467730 r2d2 S10 2-6h #1 (8)SRR029028 untreated (mock) SRR010951 Ago3 heterozygotes, oxidized GSM280087 S2cell (AGO2IP) GSM379058 GSM280086 WT ovaries (AGO2IP) S26 1st instar #2S11 2-6h #2 (9)GSM180333 late embryo (12-24) S19 2-4day pupae #1S24 male body #2SRR014282 Ovary_rep1 wK_P SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM239051 S2 cells, beta-eliminated GSM180332 mid embryo (6-10) GSM180335 imaginal discs V098 dcr-2[L811fsX] ovaryGSM180328 adult heads (female heads, male heads) GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown GSM379065 Zuc Heterozygote S7 12-24hr embryoSRR010957 Aub IP in Ago3 trans-heterozygotes SRR031693_4 SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown GSM424740 S2 pKF63 stably transfected SRR023400 total RNA extracted from P19 cells GSM379063 Vasa Heterozygote SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM280084 loqs-/- ovaries (18-29nt) GSM379054 Flam Heterozygote S18 3rd inster #2GSM379052 Aub Heterozygote V065 dcr-2[L811fsX], ovary, AGO1IPSRR001343 dcr-2 non-beta-eliminated GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries S1 male headGSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars S3 male bodySRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P GSM180331 early embryo (2-6) SRR014277 Ovary_rep1 NA_P GSM180330 very early embryo (0-1) S5 imaginal discGSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownGSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 S21 disk #2SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb S20 2-4day pupae#2SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb GSM379061 Squ Heterozygote SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM343287 Drosophila Toll 10b mutant embryos V001 IR-SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes SRR001338 IR non-beta-eliminated GSM239052 S2 cells, non beta-eliminated GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental GSM280083 dcr-2-/- ovaries (18-29nt) GSM379059 SRR032093 ago1 knockdown GSM280085 WT testes (18-24nt) GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated V084 female, one dayS17 3rd inster #1SRR010953 Aub heterozygotes, oxidized
......ATGGAGACATCCGGGATAAGCACGTC.................................................................................................................2611000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......TGGAGACATCCGGGATAAGCACGTCA................................................................................................................2611000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........AGACATCCGGGATAAGCA.....................................................................................................................1811000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGTTGTT.....................................................................................251120061060122405113000470302360000402010000201020210101011012002002000100000111000010000000001100000010100100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGTTGTTAAA..................................................................................2811000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGTTGTTA....................................................................................26141033407010120000210203010000200110100102010000010000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGTTG.......................................................................................2314700131400000000000100080200000010200000010000000000000000010000000000100000000000000011000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGTTGTTAAAT.................................................................................2911000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGTTGT......................................................................................2416000002000001000000000000100000000000100000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGTT........................................................................................22127005400210100000110000100000000110100010000100001100000000010000000000000000000000100010010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGT.........................................................................................2115000100000001000000000000010000000000010000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................GTAAGCATTGCAAAATGTAGTTGTTAA...................................................................................2712002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
....................................TAAGCATTGCAAAATGTAGTTG.......................................................................................2211000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.....................................AAGCATTGCAAAATGTAGTTGT......................................................................................2211000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................AAATTCGCTCTTCAATCATTAA...............................................................2211000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................AAATTCGCTCTTCAATCATT.................................................................2011000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................AATTCGCTCTTCAATCATTA................................................................2012000000000010000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................ACAACATTTACAATGTTTGCA...........................................21145140160640402305000000000010000004000000000000000000000000200000000010000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................ACAACATTTACAATGTTTGC............................................20181142012300070011030005000000003000000040000001001000022010000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................ACAACATTTACAATGTTTG.............................................1914400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................ACAACATTTACAATGTTTGCAG..........................................22115210001200103000000000000000000000101000000100000000000000000000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................................CAACATTTACAATGTTTGCAGG.........................................2214020000000000000000001000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................................CAACATTTACAATGTTTGC............................................191502900011007000024000000001002010000100000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................................CAACATTTACAATGTTTGCAG..........................................21185370111241331050004200104321043100000000303010211200300100000221101000000100000000000000000101100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................................CAACATTTACAATGTTTGCA...........................................20153590000854401012000000002110000010000010110010000000000100010000000000000000000010000000000010000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................................AACATTTACAATGTTTGCAG..........................................2011000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................................TGTTTGCAGGCTGTCAACG................................1911000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................................TGTTTGCAGGCTGTCAACGTT..............................2111000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................................................................CAACGTTGATGGCCAGTTGCGATGG............2512000000000000000000000000000000000000000000002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................................................................CAACGTTGATGGCCAGTTGCGATGGT...........2611000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................................................................................TTGCGATGGTTCCAGTCAAT.2011000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                                                 SizeBlastTotalS33 KC-48 #2SRR031703 Total small RNAs from r2d2 homozygous flies V028 CMEW1 Cl.8+ cellV033 CMEW1 Cl.8+ cellS32 s2+48 #2V081 embryo 2-6hrSRR031696_2152 SRR031692 Total small RNAs from Oregon R S16 KC -48 #1SRR031701 Total small RNAs from r2d2 heterozygous flies V076 ML-DmBG3-C2SRR031697 Total small RNAs from dcr-2 heterozygous flies S30 s2-48 #2S29 male head #1S35 KC+48 #2V088 r2d2[1] ovary total RNA  V024 kc167 cellS12 6-10h #1 (10)SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR029030 dcr-2 knockdown V018 Kc167 cellV010 MLDmD20c5V067 S2-NPOSS6 Drosophila OSS cell small RNA libraries, rep2 SRR029633 total small RNAs from hen1 homozygous flies OSS8 Drosophila OSS cell small RNA libraries, rep4 S31 s2+48 #1V082 embryo 14-24hrOSS2 Drosophila OSS cell small RNA libraries, rep1 SRR032094 ago2 knockdown V009 CMEL1V008 S2-DRSCS9 0-1h #3 (7)V019 GM2 cellS13 6-10h #2 (11)GSM467729 WT V089 ago2[414] ovary total RNA  V026 1182-4H cellV097 CS ovaryOSS7 Drosophila OSS cell small RNA libraries, rep3 V025 S2R+ cellS28 0-2d pupaeSRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 SRR001347 ago2 untreated S14 0-1hr #1 (A)GSM379056 Krimp Heterozygote V020 S2R+ cellGSM379064 Vasa Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies S15 S2 -48 #1S22 female head #1GSM379057 Krimp Mutant V090 CS  male total RNA  SRR001349 heterozygous dcr-2_untreated V066 r2d2[1], ovary, AGO1IPSRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR029032 r2d2 knockdown S8 S2-48,+48, KC-48, +48 mixSRR001348 ago2 oxidized V075 ML-DmBG1-C1SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies S27 0-1d Pupae (w)S2 female headGSM379066 Zuc Mutant V064 ago2[414], ovary, AGO1IPGSM379067 SpnE Mutant SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR031699 Total small RNAs from dcr-2 homozygous flies V002 IR+SRR001341 WT_males non-beta-eliminated V063 CS,ovary,AGO1IPS4 female bodySRR010952 Ago3 trans-heterozygotes, oxidized S23 female body #2SRR010956 Piwi IP in Ago3 heterozygotes SRR010954 Aub trans-heterozygotes, oxidized SRR001345 ago2 non-beta-eliminated GSM180337 tissue culture cells (S2 only) SRR014275 Ovary_rep1 LK_P S34 KC+48 #1GSM467731 loq SRR014273 Ovary_rep1_Har_P SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies GSM280088 S2cell (AGO1IP) S25 1st instar #1V021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated SRR001339 WT_females non-beta-eliminated GSM379051 Armi Mutant SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb GSM379062 Squ Mutant V011 Sg4SRR001664 homozygous dcr-2_untreated SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM280082 WT ovaries (18-29nt) GSM379060 SpnE Heterozygote V083 male, one dayGSM467730 r2d2 S10 2-6h #1 (8)SRR029028 untreated (mock) SRR010951 Ago3 heterozygotes, oxidized GSM280087 S2cell (AGO2IP) GSM379058 GSM280086 WT ovaries (AGO2IP) S26 1st instar #2S11 2-6h #2 (9)GSM180333 late embryo (12-24) S19 2-4day pupae #1S24 male body #2SRR014282 Ovary_rep1 wK_P SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM239051 S2 cells, beta-eliminated GSM180332 mid embryo (6-10) GSM180335 imaginal discs V098 dcr-2[L811fsX] ovaryGSM180328 adult heads (female heads, male heads) GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown GSM379065 Zuc Heterozygote S7 12-24hr embryoSRR010957 Aub IP in Ago3 trans-heterozygotes SRR031693_4 SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown GSM424740 S2 pKF63 stably transfected SRR023400 total RNA extracted from P19 cells GSM379063 Vasa Heterozygote SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM280084 loqs-/- ovaries (18-29nt) GSM379054 Flam Heterozygote S18 3rd inster #2GSM379052 Aub Heterozygote V065 dcr-2[L811fsX], ovary, AGO1IPSRR001343 dcr-2 non-beta-eliminated GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries S1 male headGSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars S3 male bodySRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P GSM180331 early embryo (2-6) SRR014277 Ovary_rep1 NA_P GSM180330 very early embryo (0-1) S5 imaginal discGSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownGSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 S21 disk #2SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb S20 2-4day pupae#2SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb GSM379061 Squ Heterozygote SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM343287 Drosophila Toll 10b mutant embryos V001 IR-SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes SRR001338 IR non-beta-eliminated GSM239052 S2 cells, non beta-eliminated GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental GSM280083 dcr-2-/- ovaries (18-29nt) GSM379059 SRR032093 ago1 knockdown GSM280085 WT testes (18-24nt) GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated V084 female, one dayS17 3rd inster #1SRR010953 Aub heterozygotes, oxidized
......................................................GTTGTTAAATTCGCTCTTCAATCATTA................................................................2711000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.....................................................................................................................TGGCCAGTTGCGATGGTTCCA.......2111000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000