Page generated on Fri Oct 15 12:01:54 2010

dme-mir-287




dme-mir-287

View dme-mir-287 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-2871421412138913


GTATGTATGTAAGCCCACTCACAGAGGACGCCGGGGATGTATGGGTGTGTAGGGTCTGAAATTTTGCACACATTTACAATAATTGTAAATGTGTTGAAAATCGTTTGCACGACTGTGAGCAAAACACGTCGGAGAAGAAATT
...........................(((((.(.......).))))).((.(((((((((((((..(((((((((((.....)))))))))))...)))..)))).)).)))).)).........................-23.80
.......(((((((.......(((((.(((((.(.......).))))).)....))))...(((((.(((((((((((.....))))))))))))))))...)))))))(((((((.......))).))))...........-34.40
Sense strand
                                                                                                                                              SizeBlastTotalS29 male head #1S28 0-2d pupaeS33 KC-48 #2S27 0-1d Pupae (w)S14 0-1hr #1 (A)S32 s2+48 #2SRR010952 Ago3 trans-heterozygotes, oxidized GSM467731 loq S1 male headGSM280087 S2cell (AGO2IP) GSM379067 SpnE Mutant GSM379058 GSM280086 WT ovaries (AGO2IP) SRR001347 ago2 untreated V090 CS  male total RNA  S26 1st instar #2SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 V008 S2-DRSCS11 2-6h #2 (9)GSM180333 late embryo (12-24) V018 Kc167 cellS19 2-4day pupae #1S24 male body #2SRR014282 Ovary_rep1 wK_P SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM239051 S2 cells, beta-eliminated SRR029633 total small RNAs from hen1 homozygous flies SRR032094 ago2 knockdown S9 0-1h #3 (7)SRR031699 Total small RNAs from dcr-2 homozygous flies GSM180332 mid embryo (6-10) V002 IR+SRR031692 Total small RNAs from Oregon R V009 CMEL1S16 KC -48 #1OSS8 Drosophila OSS cell small RNA libraries, rep4 SRR001341 WT_males non-beta-eliminated V063 CS,ovary,AGO1IPGSM180335 imaginal discs V098 dcr-2[L811fsX] ovaryGSM180328 adult heads (female heads, male heads) S4 female bodyV019 GM2 cellGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown V088 r2d2[1] ovary total RNA  GSM379065 Zuc Heterozygote S7 12-24hr embryoS31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes SRR031693_4 S13 6-10h #2 (11)SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote GSM379056 Krimp Heterozygote GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated V076 ML-DmBG3-C2SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized S23 female body #2SRR029033 lacZ knockdown SRR001349 heterozygous dcr-2_untreated V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V082 embryo 14-24hrSRR001345 ago2 non-beta-eliminated GSM379063 Vasa Heterozygote V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells V066 r2d2[1], ovary, AGO1IPSRR001340 IR beta-eliminated GSM280084 loqs-/- ovaries (18-29nt) SRR031703 Total small RNAs from r2d2 homozygous flies GSM379054 Flam Heterozygote S18 3rd inster #2GSM379052 Aub Heterozygote SRR014275 Ovary_rep1 LK_P S34 KC+48 #1V065 dcr-2[L811fsX], ovary, AGO1IPOSS2 Drosophila OSS cell small RNA libraries, rep1 SRR001343 dcr-2 non-beta-eliminated GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM467729 WT SRR014273 Ovary_rep1_Har_P V089 ago2[414] ovary total RNA  GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR031697 Total small RNAs from dcr-2 heterozygous flies SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM379064 Vasa Mutant GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars V028 CMEW1 Cl.8+ cellGSM280088 S2cell (AGO1IP) S3 male bodySRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P V026 1182-4H cellGSM180331 early embryo (2-6) V097 CS ovaryS25 1st instar #1SRR029032 r2d2 knockdown SRR014277 Ovary_rep1 NA_P S8 S2-48,+48, KC-48, +48 mixOSS7 Drosophila OSS cell small RNA libraries, rep3 GSM180330 very early embryo (0-1) S5 imaginal discGSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated S15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized S21 disk #2GSM379051 Armi Mutant V075 ML-DmBG1-C1SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S30 s2-48 #2GSM379062 Squ Mutant V011 Sg4V025 S2R+ cellS20 2-4day pupae#2SRR031696_2152 SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR001664 homozygous dcr-2_untreated GSM379061 Squ Heterozygote SRR010958 Piwi IP in Ago3 trans-heterozygotes SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM343287 Drosophila Toll 10b mutant embryos V067 S2-NPGSM280082 WT ovaries (18-29nt) V001 IR-S22 female head #1SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes GSM379060 SpnE Heterozygote V083 male, one daySRR001338 IR non-beta-eliminated SRR031701 Total small RNAs from r2d2 heterozygous flies SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 S10 2-6h #1 (8)GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental OSS6 Drosophila OSS cell small RNA libraries, rep2 S2 female headGSM280083 dcr-2-/- ovaries (18-29nt) GSM379059 SRR029028 untreated (mock) SRR032093 ago1 knockdown V024 kc167 cellV033 CMEW1 Cl.8+ cellGSM280085 WT testes (18-24nt) GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated S12 6-10h #1 (10)V084 female, one daySRR010951 Ago3 heterozygotes, oxidized S17 3rd inster #1SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V081 embryo 2-6hrGSM379057 Krimp Mutant GSM379066 Zuc Mutant SRR010953 Aub heterozygotes, oxidized V064 ago2[414], ovary, AGO1IPS35 KC+48 #2
.................................................................GCACACATTTACAATAATTGTA.......................................................2211000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................................................................TGTGTTGAAAATCGTTTGCAC................................21113332211001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                                              SizeBlastTotalS29 male head #1S28 0-2d pupaeS33 KC-48 #2S27 0-1d Pupae (w)S14 0-1hr #1 (A)S32 s2+48 #2SRR010952 Ago3 trans-heterozygotes, oxidized GSM467731 loq S1 male headGSM280087 S2cell (AGO2IP) GSM379067 SpnE Mutant GSM379058 GSM280086 WT ovaries (AGO2IP) SRR001347 ago2 untreated V090 CS  male total RNA  S26 1st instar #2SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 V008 S2-DRSCS11 2-6h #2 (9)GSM180333 late embryo (12-24) V018 Kc167 cellS19 2-4day pupae #1S24 male body #2SRR014282 Ovary_rep1 wK_P SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM239051 S2 cells, beta-eliminated SRR029633 total small RNAs from hen1 homozygous flies SRR032094 ago2 knockdown S9 0-1h #3 (7)SRR031699 Total small RNAs from dcr-2 homozygous flies GSM180332 mid embryo (6-10) V002 IR+SRR031692 Total small RNAs from Oregon R V009 CMEL1S16 KC -48 #1OSS8 Drosophila OSS cell small RNA libraries, rep4 SRR001341 WT_males non-beta-eliminated V063 CS,ovary,AGO1IPGSM180335 imaginal discs V098 dcr-2[L811fsX] ovaryGSM180328 adult heads (female heads, male heads) S4 female bodyV019 GM2 cellGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown V088 r2d2[1] ovary total RNA  GSM379065 Zuc Heterozygote S7 12-24hr embryoS31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes SRR031693_4 S13 6-10h #2 (11)SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote GSM379056 Krimp Heterozygote GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated V076 ML-DmBG3-C2SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized S23 female body #2SRR029033 lacZ knockdown SRR001349 heterozygous dcr-2_untreated V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V082 embryo 14-24hrSRR001345 ago2 non-beta-eliminated GSM379063 Vasa Heterozygote V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells V066 r2d2[1], ovary, AGO1IPSRR001340 IR beta-eliminated GSM280084 loqs-/- ovaries (18-29nt) SRR031703 Total small RNAs from r2d2 homozygous flies GSM379054 Flam Heterozygote S18 3rd inster #2GSM379052 Aub Heterozygote SRR014275 Ovary_rep1 LK_P S34 KC+48 #1V065 dcr-2[L811fsX], ovary, AGO1IPOSS2 Drosophila OSS cell small RNA libraries, rep1 SRR001343 dcr-2 non-beta-eliminated GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM467729 WT SRR014273 Ovary_rep1_Har_P V089 ago2[414] ovary total RNA  GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR031697 Total small RNAs from dcr-2 heterozygous flies SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM379064 Vasa Mutant GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars V028 CMEW1 Cl.8+ cellGSM280088 S2cell (AGO1IP) S3 male bodySRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P V026 1182-4H cellGSM180331 early embryo (2-6) V097 CS ovaryS25 1st instar #1SRR029032 r2d2 knockdown SRR014277 Ovary_rep1 NA_P S8 S2-48,+48, KC-48, +48 mixOSS7 Drosophila OSS cell small RNA libraries, rep3 GSM180330 very early embryo (0-1) S5 imaginal discGSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated S15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized S21 disk #2GSM379051 Armi Mutant V075 ML-DmBG1-C1SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S30 s2-48 #2GSM379062 Squ Mutant V011 Sg4V025 S2R+ cellS20 2-4day pupae#2SRR031696_2152 SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR001664 homozygous dcr-2_untreated GSM379061 Squ Heterozygote SRR010958 Piwi IP in Ago3 trans-heterozygotes SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM343287 Drosophila Toll 10b mutant embryos V067 S2-NPGSM280082 WT ovaries (18-29nt) V001 IR-S22 female head #1SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes GSM379060 SpnE Heterozygote V083 male, one daySRR001338 IR non-beta-eliminated SRR031701 Total small RNAs from r2d2 heterozygous flies SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 S10 2-6h #1 (8)GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental OSS6 Drosophila OSS cell small RNA libraries, rep2 S2 female headGSM280083 dcr-2-/- ovaries (18-29nt) GSM379059 SRR029028 untreated (mock) SRR032093 ago1 knockdown V024 kc167 cellV033 CMEW1 Cl.8+ cellGSM280085 WT testes (18-24nt) GSM180329 adult bodies (female bodies, male bodies) SRR001346 ago2 beta-eliminated S12 6-10h #1 (10)V084 female, one daySRR010951 Ago3 heterozygotes, oxidized S17 3rd inster #1SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V081 embryo 2-6hrGSM379057 Krimp Mutant GSM379066 Zuc Mutant SRR010953 Aub heterozygotes, oxidized V064 ago2[414], ovary, AGO1IPS35 KC+48 #2
...................................GATGTATGGGTGTGTAGGGTCTGA...................................................................................2411000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000