Page generated on Fri Oct 15 12:01:51 2010

dme-mir-303




dme-mir-303

View dme-mir-303 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-3031192474252188283122188283


TAGTGTTAAAAAACCAAATTGATATCTTGGTTTAGGTTTCACAGGAAACTGGTTTAATAACGAAAACTAGTTTCCTCTAAAATCCTAATCAAGACATCATGTGTCGTCGCATCGAGAAG
........................((((((((..(((((.(.(((((((((((((........))))))))))))).).)))))..)))))))).........................-26.90
...................((((.((((((((..(((((.(.(((((((((((((........))))))))))))).).)))))..)))))))).))))..(.(((......))).)..-33.40
Sense strand
                                                                                                                       SizeBlastTotalV076 ML-DmBG3-C2S21 disk #2S5 imaginal discGSM280085 WT testes (18-24nt) S24 male body #2S9 0-1h #3 (7)GSM280082 WT ovaries (18-29nt) GSM180335 imaginal discs S19 2-4day pupae #1S32 s2+48 #2V098 dcr-2[L811fsX] ovarySRR031697 Total small RNAs from dcr-2 heterozygous flies S28 0-2d pupaeGSM379065 Zuc Heterozygote S29 male head #1V081 embryo 2-6hrS33 KC-48 #2SRR031696_2152 OSS2 Drosophila OSS cell small RNA libraries, rep1 S3 male bodyV084 female, one dayV083 male, one dayS31 s2+48 #1S34 KC+48 #1S35 KC+48 #2OSS7 Drosophila OSS cell small RNA libraries, rep3 S27 0-1d Pupae (w)SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 V024 kc167 cellOSS6 Drosophila OSS cell small RNA libraries, rep2 V090 CS  male total RNA  V082 embryo 14-24hrS10 2-6h #1 (8)V097 CS ovaryV018 Kc167 cellSRR031699 Total small RNAs from dcr-2 homozygous flies S16 KC -48 #1GSM379057 Krimp Mutant SRR031692 Total small RNAs from Oregon R S18 3rd inster #2S15 S2 -48 #1SRR010953 Aub heterozygotes, oxidized SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR029633 total small RNAs from hen1 homozygous flies OSS8 Drosophila OSS cell small RNA libraries, rep4 SRR010954 Aub trans-heterozygotes, oxidized V065 dcr-2[L811fsX], ovary, AGO1IPS30 s2-48 #2SRR001664 homozygous dcr-2_untreated V088 r2d2[1] ovary total RNA  V066 r2d2[1], ovary, AGO1IPSRR010959 Ago3 IP in heterozygotes S8 S2-48,+48, KC-48, +48 mixSRR031701 Total small RNAs from r2d2 heterozygous flies S17 3rd inster #1GSM379066 Zuc Mutant S23 female body #2V089 ago2[414] ovary total RNA  GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies S22 female head #1GSM379067 SpnE Mutant V002 IR+S7 12-24hr embryoSRR031693_4 GSM379063 Vasa Heterozygote GSM379062 Squ Mutant GSM379059 GSM379058 SRR001347 ago2 untreated S11 2-6h #2 (9)SRR014282 Ovary_rep1 wK_P V009 CMEL1GSM379056 Krimp Heterozygote SRR014275 Ovary_rep1 LK_P GSM180334 larvae: 1st instar and 3rd instars V028 CMEW1 Cl.8+ cellV026 1182-4H cellGSM379051 Armi Mutant SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies S2 female headSRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V064 ago2[414], ovary, AGO1IPSRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 GSM180333 late embryo (12-24) SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 S14 0-1hr #1 (A)V063 CS,ovary,AGO1IPS4 female bodyS13 6-10h #2 (11)SRR001349 heterozygous dcr-2_untreated V010 MLDmD20c5GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized GSM280084 loqs-/- ovaries (18-29nt) SRR031703 Total small RNAs from r2d2 homozygous flies SRR001343 dcr-2 non-beta-eliminated GSM467731 loq S1 male headSRR014273 Ovary_rep1_Har_P GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM280088 S2cell (AGO1IP) SRR014280 Ovary_rep1 w1118_P GSM180331 early embryo (2-6) S25 1st instar #1SRR014277 Ovary_rep1 NA_P V075 ML-DmBG1-C1SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb V067 S2-NPGSM379060 SpnE Heterozygote SRR001338 IR non-beta-eliminated GSM239052 S2 cells, non beta-eliminated GSM280083 dcr-2-/- ovaries (18-29nt) SRR029028 untreated (mock) V033 CMEW1 Cl.8+ cellGSM180329 adult bodies (female bodies, male bodies) S12 6-10h #1 (10)GSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) S26 1st instar #2V008 S2-DRSCGSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown GSM180332 mid embryo (6-10) SRR001341 WT_males non-beta-eliminated GSM180328 adult heads (female heads, male heads) V019 GM2 cellGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown SRR010957 Aub IP in Ago3 trans-heterozygotes SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR023400 total RNA extracted from P19 cells SRR001345 ago2 non-beta-eliminated V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM379054 Flam Heterozygote GSM379052 Aub Heterozygote GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM467729 WT GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM379064 Vasa Mutant GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown SRR029029 dcr-1 knockdown SRR029032 r2d2 knockdown GSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb V011 Sg4V025 S2R+ cellS20 2-4day pupae#2SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb GSM379061 Squ Heterozygote SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM343287 Drosophila Toll 10b mutant embryos V001 IR-SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes SRR029030 dcr-2 knockdown GSM467730 r2d2 GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental SRR032093 ago1 knockdown SRR001346 ago2 beta-eliminated SRR010951 Ago3 heterozygotes, oxidized
.............CCAAATTGATATCTTGGTT.......................................................................................1911010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............CAAATTGATATCTTGGTT.......................................................................................1814300000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................TTTAGGTTTCACAGGAAACTGGTT.................................................................241282400000000000000000000000001000000000000000010001000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................TTTAGGTTTCACAGGAAACTGG...................................................................2213300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................TTTAGGTTTCACAGGAAACTG....................................................................2112200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................TTTAGGTTTCACAGGAAACT.....................................................................2013300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................TTTAGGTTTCACAGGAAACTGGTTT................................................................2511100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................TTTAGGTTTCACAGGAAACTGGT..................................................................231403210000000030110000000000000000000000000000000000000000000000001000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................TTTAGGTTTCACAGGAAAC......................................................................1911000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................TTAGGTTTCACAGGAAACTGGTT.................................................................231361711201400011000001000000000000000020000000000000000000000001001000010000000100000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................TTAGGTTTCACAGGAAACTGG...................................................................21111231011000001000000000100000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................TTAGGTTTCACAGGAAACTG....................................................................2012100100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................TTAGGTTTCACAGGAAACTGGTTT................................................................2414110000000000100000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................TTAGGTTTCACAGGAAACTGGT..................................................................221613322400310023220100000100000001000000000000010000000000011000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................TTAGGTTTCACAGGAAAC......................................................................1811000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................TTAGGTTTCACAGGAAACT.....................................................................1911100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................TAGGTTTCACAGGAAACTGG...................................................................20114210510100001000000010000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000
................................TAGGTTTCACAGGAAACTGGT..................................................................211263102321247812622101340700000801300042233011201020000003012100000010010000111000000010110000000011000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000
................................TAGGTTTCACAGGAAACT.....................................................................1813000000000000000000000000000000000000000000100020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................TAGGTTTCACAGGAAACTGGTT.................................................................22116403453022735364404340262914201419513172015111971071114130978641066564646016602452455423223030310212222022102110220110100011101110110110111010101101100000000000000000000000000000000000000000000000000000000000000000000000
................................TAGGTTTCACAGGAAACTG....................................................................1918000100000000007000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................TAGGTTTCACAGGAAACTGGTTT................................................................23153736555000101000000230002000002011000012011000000001000010000000000000000000010000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................AGGTTTCACAGGAAACTGGTT.................................................................2111100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................AGGTTTCACAGGAAACTGGTTT................................................................2213000000100020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................GGTTTCACAGGAAACTGGTT.................................................................2015010120001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
....................................TTTCACAGGAAACTGGTT.................................................................1814100200000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................ACTAGTTTCCTCTAAAATCCTA................................2211000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................CTAGTTTCCTCTAAAATC...................................1813000000000000000000000000000000000000000000100020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................CTAGTTTCCTCTAAAATCCTAATC.............................2413000010000000000000000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................CTAGTTTCCTCTAAAATCCTA................................2115801017012021012013000120021000300001001000100010000100000000000100002000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................CTAGTTTCCTCTAAAATCC..................................1914000300000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................CTAGTTTCCTCTAAAATCCTAA...............................22115503925121713077200400000130001100700100000000000200000100000110110100021000000000000002000000000000000000001001000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................CTAGTTTCCTCTAAAATCCTAAT..............................23132045910001101000000000003000200000000000000000000000000000000001000000000200000000000000000100010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................CTAGTTTCCTCTAAAATCCT.................................2015000000000000000000000020000000000000000000100010000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................TAGTTTCCTCTAAAATCCTAA...............................2113011000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................TAGTTTCCTCTAAAATCCTAATC.............................2314000120000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................TAGTTTCCTCTAAAATCCT.................................1912000000000000000000000000000100000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................TAGTTTCCTCTAAAATCCTAAT..............................22111020210000000000140100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                       SizeBlastTotalV076 ML-DmBG3-C2S21 disk #2S5 imaginal discGSM280085 WT testes (18-24nt) S24 male body #2S9 0-1h #3 (7)GSM280082 WT ovaries (18-29nt) GSM180335 imaginal discs S19 2-4day pupae #1S32 s2+48 #2V098 dcr-2[L811fsX] ovarySRR031697 Total small RNAs from dcr-2 heterozygous flies S28 0-2d pupaeGSM379065 Zuc Heterozygote S29 male head #1V081 embryo 2-6hrS33 KC-48 #2SRR031696_2152 OSS2 Drosophila OSS cell small RNA libraries, rep1 S3 male bodyV084 female, one dayV083 male, one dayS31 s2+48 #1S34 KC+48 #1S35 KC+48 #2OSS7 Drosophila OSS cell small RNA libraries, rep3 S27 0-1d Pupae (w)SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 V024 kc167 cellOSS6 Drosophila OSS cell small RNA libraries, rep2 V090 CS  male total RNA  V082 embryo 14-24hrS10 2-6h #1 (8)V097 CS ovaryV018 Kc167 cellSRR031699 Total small RNAs from dcr-2 homozygous flies S16 KC -48 #1GSM379057 Krimp Mutant SRR031692 Total small RNAs from Oregon R S18 3rd inster #2S15 S2 -48 #1SRR010953 Aub heterozygotes, oxidized SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 SRR029633 total small RNAs from hen1 homozygous flies OSS8 Drosophila OSS cell small RNA libraries, rep4 SRR010954 Aub trans-heterozygotes, oxidized V065 dcr-2[L811fsX], ovary, AGO1IPS30 s2-48 #2SRR001664 homozygous dcr-2_untreated V088 r2d2[1] ovary total RNA  V066 r2d2[1], ovary, AGO1IPSRR010959 Ago3 IP in heterozygotes S8 S2-48,+48, KC-48, +48 mixSRR031701 Total small RNAs from r2d2 heterozygous flies S17 3rd inster #1GSM379066 Zuc Mutant S23 female body #2V089 ago2[414] ovary total RNA  GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies S22 female head #1GSM379067 SpnE Mutant V002 IR+S7 12-24hr embryoSRR031693_4 GSM379063 Vasa Heterozygote GSM379062 Squ Mutant GSM379059 GSM379058 SRR001347 ago2 untreated S11 2-6h #2 (9)SRR014282 Ovary_rep1 wK_P V009 CMEL1GSM379056 Krimp Heterozygote SRR014275 Ovary_rep1 LK_P GSM180334 larvae: 1st instar and 3rd instars V028 CMEW1 Cl.8+ cellV026 1182-4H cellGSM379051 Armi Mutant SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies S2 female headSRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V064 ago2[414], ovary, AGO1IPSRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 GSM180333 late embryo (12-24) SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 S14 0-1hr #1 (A)V063 CS,ovary,AGO1IPS4 female bodyS13 6-10h #2 (11)SRR001349 heterozygous dcr-2_untreated V010 MLDmD20c5GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized GSM280084 loqs-/- ovaries (18-29nt) SRR031703 Total small RNAs from r2d2 homozygous flies SRR001343 dcr-2 non-beta-eliminated GSM467731 loq S1 male headSRR014273 Ovary_rep1_Har_P GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM280088 S2cell (AGO1IP) SRR014280 Ovary_rep1 w1118_P GSM180331 early embryo (2-6) S25 1st instar #1SRR014277 Ovary_rep1 NA_P V075 ML-DmBG1-C1SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb V067 S2-NPGSM379060 SpnE Heterozygote SRR001338 IR non-beta-eliminated GSM239052 S2 cells, non beta-eliminated GSM280083 dcr-2-/- ovaries (18-29nt) SRR029028 untreated (mock) V033 CMEW1 Cl.8+ cellGSM180329 adult bodies (female bodies, male bodies) S12 6-10h #1 (10)GSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) S26 1st instar #2V008 S2-DRSCGSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown GSM180332 mid embryo (6-10) SRR001341 WT_males non-beta-eliminated GSM180328 adult heads (female heads, male heads) V019 GM2 cellGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown SRR010957 Aub IP in Ago3 trans-heterozygotes SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379050 Armi Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR023400 total RNA extracted from P19 cells SRR001345 ago2 non-beta-eliminated V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM379054 Flam Heterozygote GSM379052 Aub Heterozygote GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM467729 WT GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM379064 Vasa Mutant GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown SRR029029 dcr-1 knockdown SRR029032 r2d2 knockdown GSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb V011 Sg4V025 S2R+ cellS20 2-4day pupae#2SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb GSM379061 Squ Heterozygote SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM343287 Drosophila Toll 10b mutant embryos V001 IR-SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes SRR029030 dcr-2 knockdown GSM467730 r2d2 GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental SRR032093 ago1 knockdown SRR001346 ago2 beta-eliminated SRR010951 Ago3 heterozygotes, oxidized
................................................................AACTAGTTTCCTCTAAAATCCT.................................2212000000000001000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000