Page generated on Fri Oct 15 12:01:51 2010

dme-mir-955




dme-mir-955

View dme-mir-955 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-955146253618245968218245968


GTAAAATAGGTAAGGAACACTTTTTGGCCAGCTAATCAACTCCATCGTGCAGAGGTTTGAGTGTCCTGTGTTTTGCCTAATCGCATTCAATTTCTGAACGGTAGAGATGGTACGCTTAGAAACAACCTAAAACAATTTTATCTTAT
.............................(((..((((.(((.(((((.((((((((.((((((.....(......).....)))))))))))))).))))).))).))))..)))..............................-26.80
......(((((..((....(.....).)).((..((((.(((.(((((.((((((((.((((((.....(......).....)))))))))))))).))))).))).))))..)).........))))).................-31.90
Sense strand
                                                                                                                                                  SizeBlastTotalV082 embryo 14-24hrV001 IR-V002 IR+SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 V083 male, one dayS7 12-24hr embryoS28 0-2d pupaeS24 male body #2V084 female, one dayV090 CS  male total RNA  V098 dcr-2[L811fsX] ovaryS29 male head #1S27 0-1d Pupae (w)V097 CS ovaryS22 female head #1V089 ago2[414] ovary total RNA  S19 2-4day pupae #1V021 ML-DmD21 cellV081 embryo 2-6hrSRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies GSM379066 Zuc Mutant GSM180333 late embryo (12-24) V063 CS,ovary,AGO1IPV088 r2d2[1] ovary total RNA  SRR031703 Total small RNAs from r2d2 homozygous flies S2 female headGSM379067 SpnE Mutant SRR031692 Total small RNAs from Oregon R SRR031693_4 SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 SRR031699 Total small RNAs from dcr-2 homozygous flies SRR001345 ago2 non-beta-eliminated GSM379051 Armi Mutant V064 ago2[414], ovary, AGO1IPSRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM379054 Flam Heterozygote V065 dcr-2[L811fsX], ovary, AGO1IPGSM379061 Squ Heterozygote GSM280085 WT testes (18-24nt) S17 3rd inster #1GSM379057 Krimp Mutant S9 0-1h #3 (7)GSM379063 Vasa Heterozygote S18 3rd inster #2SRR014275 Ovary_rep1 LK_P GSM467729 WT GSM239050 fly heads, beta-eliminated V026 1182-4H cellS20 2-4day pupae#2SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM379058 SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR029633 total small RNAs from hen1 homozygous flies S23 female body #2SRR014277 Ovary_rep1 NA_P GSM467730 r2d2 SRR014282 Ovary_rep1 wK_P S4 female bodySRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR031697 Total small RNAs from dcr-2 heterozygous flies SRR014280 Ovary_rep1 w1118_P SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR031696_2152 SRR031701 Total small RNAs from r2d2 heterozygous flies GSM379059 S12 6-10h #1 (10)V020 S2R+ cellV066 r2d2[1], ovary, AGO1IPSRR001343 dcr-2 non-beta-eliminated GSM379064 Vasa Mutant GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies S3 male bodyS25 1st instar #1V025 S2R+ cellSRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb GSM379060 SpnE Heterozygote SRR001347 ago2 untreated S26 1st instar #2GSM379065 Zuc Heterozygote S13 6-10h #2 (11)GSM379056 Krimp Heterozygote SRR014273 Ovary_rep1_Har_P V028 CMEW1 Cl.8+ cellGSM180329 adult bodies (female bodies, male bodies) V008 S2-DRSCGSM180332 mid embryo (6-10) SRR001337 WT_females beta-eliminated V076 ML-DmBG3-C2GSM280084 loqs-/- ovaries (18-29nt) GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown S5 imaginal discSRR001344 dcr-2 beta-eliminated V075 ML-DmBG1-C1SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb GSM379062 Squ Mutant SRR001664 homozygous dcr-2_untreated V067 S2-NPGSM280082 WT ovaries (18-29nt) SRR001338 IR non-beta-eliminated V033 CMEW1 Cl.8+ cellGSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) S11 2-6h #2 (9)V018 Kc167 cellGSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown S14 0-1hr #1 (A)V009 CMEL1S16 KC -48 #1OSS8 Drosophila OSS cell small RNA libraries, rep4 SRR001341 WT_males non-beta-eliminated GSM180335 imaginal discs GSM180328 adult heads (female heads, male heads) V019 GM2 cellGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown S32 s2+48 #2S31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes GSM379050 Armi Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown SRR001349 heterozygous dcr-2_untreated V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM379052 Aub Heterozygote S34 KC+48 #1OSS2 Drosophila OSS cell small RNA libraries, rep1 GSM467731 loq GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries S1 male headGSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries S33 KC-48 #2GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM246084 D. melanogaster adult male heads 454 SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars GSM280088 S2cell (AGO1IP) SRR010959 Ago3 IP in heterozygotes GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown S8 S2-48,+48, KC-48, +48 mixOSS7 Drosophila OSS cell small RNA libraries, rep3 GSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownS15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized S21 disk #2SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S30 s2-48 #2V011 Sg4SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM343287 Drosophila Toll 10b mutant embryos SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated S10 2-6h #1 (8)GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental OSS6 Drosophila OSS cell small RNA libraries, rep2 GSM280083 dcr-2-/- ovaries (18-29nt) SRR029028 untreated (mock) SRR032093 ago1 knockdown V024 kc167 cellSRR001346 ago2 beta-eliminated SRR010951 Ago3 heterozygotes, oxidized SRR010953 Aub heterozygotes, oxidized S35 KC+48 #2
.......................TTGGCCAGCTAATCAACTC........................................................................................................1911000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................TGGCCAGCTAATCAACTCC.......................................................................................................1914001001200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................TGGCCAGCTAATCAACTC........................................................................................................1813001001000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................CATCGTGCAGAGGTTTGA......................................................................................1812000000011000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................CATCGTGCAGAGGTTTGAGTGTC.................................................................................23112565042711274472821172912397142981082600062455003113020546351065302102302341042011421010321332001201010101001001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................CATCGTGCAGAGGTTTGAGTGT..................................................................................22182918015596453215182231142082195651124377835203473642634120114400123322131102100321001112012000120000210010100110010010100000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................CATCGTGCAGAGGTTTGAGTG...................................................................................2112405351242380527950031604201112022031202011002010200100000100110001100000010100000001000000001000010000100100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................CATCGTGCAGAGGTTTGAG.....................................................................................19121000320001030000000001020200010100000010000000000000011000000000000000100000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................CATCGTGCAGAGGTTTGAGTGTCC................................................................................2412110000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................CATCGTGCAGAGGTTTGAGT....................................................................................20168255850012650061400001012001100010010001100001001100010010000000001000000000000000001000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................ATCGTGCAGAGGTTTGAGTG...................................................................................2017020210000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................ATCGTGCAGAGGTTTGAGTGT..................................................................................21111411000000010000000000000000100000000000000000000020000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................ATCGTGCAGAGGTTTGAGTGTCCT...............................................................................2412010000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................ATCGTGCAGAGGTTTGAGTGTCC................................................................................2313000100000000000000000000000000000000000000000000000000000000002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................ATCGTGCAGAGGTTTGAGTGTC.................................................................................22116630310000000100000000000000000000000000000000000020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................TCGTGCAGAGGTTTGAGTGTCC................................................................................2211000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................GTGCAGAGGTTTGAGTGT..................................................................................1811000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................................CATTCAATTTCTGAACGGTAGA.........................................2215216915101000001000000003000000000100000000000000000000000000000000001001000000000001020000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................................CATTCAATTTCTGAACGGTAG..........................................21114200000010000000000000000100100000001100000000000000010001000200110000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................................CATTCAATTTCTGAACGGT............................................1911001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.....................................................................................TTCAATTTCTGAACGGTAGAGA.......................................2211100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................................................................................TTAGAAACAACCTAAAAC.............1821000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                                                  SizeBlastTotalV082 embryo 14-24hrV001 IR-V002 IR+SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 V083 male, one dayS7 12-24hr embryoS28 0-2d pupaeS24 male body #2V084 female, one dayV090 CS  male total RNA  V098 dcr-2[L811fsX] ovaryS29 male head #1S27 0-1d Pupae (w)V097 CS ovaryS22 female head #1V089 ago2[414] ovary total RNA  S19 2-4day pupae #1V021 ML-DmD21 cellV081 embryo 2-6hrSRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies GSM379066 Zuc Mutant GSM180333 late embryo (12-24) V063 CS,ovary,AGO1IPV088 r2d2[1] ovary total RNA  SRR031703 Total small RNAs from r2d2 homozygous flies S2 female headGSM379067 SpnE Mutant SRR031692 Total small RNAs from Oregon R SRR031693_4 SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 SRR031699 Total small RNAs from dcr-2 homozygous flies SRR001345 ago2 non-beta-eliminated GSM379051 Armi Mutant V064 ago2[414], ovary, AGO1IPSRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM379054 Flam Heterozygote V065 dcr-2[L811fsX], ovary, AGO1IPGSM379061 Squ Heterozygote GSM280085 WT testes (18-24nt) S17 3rd inster #1GSM379057 Krimp Mutant S9 0-1h #3 (7)GSM379063 Vasa Heterozygote S18 3rd inster #2SRR014275 Ovary_rep1 LK_P GSM467729 WT GSM239050 fly heads, beta-eliminated V026 1182-4H cellS20 2-4day pupae#2SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM379058 SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR029633 total small RNAs from hen1 homozygous flies S23 female body #2SRR014277 Ovary_rep1 NA_P GSM467730 r2d2 SRR014282 Ovary_rep1 wK_P S4 female bodySRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR031697 Total small RNAs from dcr-2 heterozygous flies SRR014280 Ovary_rep1 w1118_P SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR031696_2152 SRR031701 Total small RNAs from r2d2 heterozygous flies GSM379059 S12 6-10h #1 (10)V020 S2R+ cellV066 r2d2[1], ovary, AGO1IPSRR001343 dcr-2 non-beta-eliminated GSM379064 Vasa Mutant GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies S3 male bodyS25 1st instar #1V025 S2R+ cellSRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb GSM379060 SpnE Heterozygote SRR001347 ago2 untreated S26 1st instar #2GSM379065 Zuc Heterozygote S13 6-10h #2 (11)GSM379056 Krimp Heterozygote SRR014273 Ovary_rep1_Har_P V028 CMEW1 Cl.8+ cellGSM180329 adult bodies (female bodies, male bodies) V008 S2-DRSCGSM180332 mid embryo (6-10) SRR001337 WT_females beta-eliminated V076 ML-DmBG3-C2GSM280084 loqs-/- ovaries (18-29nt) GSM379055 Flam Mutant SRR032095 AGO1 IP dcr2 knockdown S5 imaginal discSRR001344 dcr-2 beta-eliminated V075 ML-DmBG1-C1SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb GSM379062 Squ Mutant SRR001664 homozygous dcr-2_untreated V067 S2-NPGSM280082 WT ovaries (18-29nt) SRR001338 IR non-beta-eliminated V033 CMEW1 Cl.8+ cellGSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) S11 2-6h #2 (9)V018 Kc167 cellGSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown S14 0-1hr #1 (A)V009 CMEL1S16 KC -48 #1OSS8 Drosophila OSS cell small RNA libraries, rep4 SRR001341 WT_males non-beta-eliminated GSM180335 imaginal discs GSM180328 adult heads (female heads, male heads) V019 GM2 cellGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown S32 s2+48 #2S31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes GSM379050 Armi Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown SRR001349 heterozygous dcr-2_untreated V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM379052 Aub Heterozygote S34 KC+48 #1OSS2 Drosophila OSS cell small RNA libraries, rep1 GSM467731 loq GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries S1 male headGSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries S33 KC-48 #2GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM246084 D. melanogaster adult male heads 454 SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR029029 dcr-1 knockdown GSM180334 larvae: 1st instar and 3rd instars GSM280088 S2cell (AGO1IP) SRR010959 Ago3 IP in heterozygotes GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown S8 S2-48,+48, KC-48, +48 mixOSS7 Drosophila OSS cell small RNA libraries, rep3 GSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownS15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001339 WT_females non-beta-eliminated SRR001348 ago2 oxidized S21 disk #2SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb S30 s2-48 #2V011 Sg4SRR010958 Piwi IP in Ago3 trans-heterozygotes GSM343287 Drosophila Toll 10b mutant embryos SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated S10 2-6h #1 (8)GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental OSS6 Drosophila OSS cell small RNA libraries, rep2 GSM280083 dcr-2-/- ovaries (18-29nt) SRR029028 untreated (mock) SRR032093 ago1 knockdown V024 kc167 cellSRR001346 ago2 beta-eliminated SRR010951 Ago3 heterozygotes, oxidized SRR010953 Aub heterozygotes, oxidized S35 KC+48 #2
..............................................................................................................TACGCTTAGAAACAACCTA.................1911000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000