Page generated on Fri Oct 15 12:01:50 2010

dme-mir-963




dme-mir-963

View dme-mir-963 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-96313842651417984114417984


ATATGGCAATTACAACTAATTTTTCTTAGTCTAATCTAAAACAAGGTAAATATCAGGTTGTTTCCTGTATTCGATCGAAACATCTGTATATACCTTTGTTCCGATTGGACAAAAGTGCGTCTTCTAGTTGGTGATACC
............................((((((((...(((((((((.(((.(((((.(((((............))))))))))))).)))).)))))..))))))))............................-27.30
........((((((((((..........((((((((...(((((((((.(((.(((((.(((((............))))))))))))).)))).)))))..))))))))..(((.....))).))))).)))))...-32.70
Sense strand
                                                                                                                                          SizeBlastTotalGSM280085 WT testes (18-24nt) S21 disk #2S24 male body #2S5 imaginal discV090 CS  male total RNA  V083 male, one dayV097 CS ovaryS9 0-1h #3 (7)V063 CS,ovary,AGO1IPSRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 GSM180335 imaginal discs SRR031697 Total small RNAs from dcr-2 heterozygous flies S32 s2+48 #2S35 KC+48 #2SRR014277 Ovary_rep1 NA_P GSM379057 Krimp Mutant SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR014275 Ovary_rep1 LK_P S19 2-4day pupae #1GSM379061 Squ Heterozygote S28 0-2d pupaeOSS8 Drosophila OSS cell small RNA libraries, rep4 S3 male bodyGSM379065 Zuc Heterozygote V098 dcr-2[L811fsX] ovaryS10 2-6h #1 (8)GSM379051 Armi Mutant OSS6 Drosophila OSS cell small RNA libraries, rep2 S29 male head #1SRR031692 Total small RNAs from Oregon R V065 dcr-2[L811fsX], ovary, AGO1IPS34 KC+48 #1OSS7 Drosophila OSS cell small RNA libraries, rep3 GSM379056 Krimp Heterozygote SRR029633 total small RNAs from hen1 homozygous flies SRR031703 Total small RNAs from r2d2 homozygous flies GSM379066 Zuc Mutant GSM379063 Vasa Heterozygote SRR014280 Ovary_rep1 w1118_P V064 ago2[414], ovary, AGO1IPS23 female body #2V066 r2d2[1], ovary, AGO1IPGSM379055 Flam Mutant SRR031696_2152 SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V088 r2d2[1] ovary total RNA  OSS2 Drosophila OSS cell small RNA libraries, rep1 S27 0-1d Pupae (w)GSM180329 adult bodies (female bodies, male bodies) GSM379067 SpnE Mutant SRR014282 Ovary_rep1 wK_P SRR031699 Total small RNAs from dcr-2 homozygous flies SRR014273 Ovary_rep1_Har_P GSM379059 SRR029028 untreated (mock) V089 ago2[414] ovary total RNA  GSM379064 Vasa Mutant V082 embryo 14-24hrGSM379060 SpnE Heterozygote SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 S4 female bodyS13 6-10h #2 (11)GSM280084 loqs-/- ovaries (18-29nt) S18 3rd inster #2GSM379052 Aub Heterozygote SRR032095 AGO1 IP dcr2 knockdown GSM379062 Squ Mutant S22 female head #1GSM379058 GSM379050 Armi Heterozygote SRR001345 ago2 non-beta-eliminated V084 female, one daySRR001341 WT_males non-beta-eliminated V010 MLDmD20c5SRR001339 WT_females non-beta-eliminated SRR031701 Total small RNAs from r2d2 heterozygous flies S17 3rd inster #1V081 embryo 2-6hrGSM379053 Aub Mutant SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies S25 1st instar #1S2 female headSRR001346 ago2 beta-eliminated S12 6-10h #1 (10)V002 IR+V009 CMEL1S16 KC -48 #1GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries S7 12-24hr embryoGSM379054 Flam Heterozygote SRR001343 dcr-2 non-beta-eliminated S1 male headGSM467729 WT S33 KC-48 #2GSM180334 larvae: 1st instar and 3rd instars V028 CMEW1 Cl.8+ cellV026 1182-4H cellS8 S2-48,+48, KC-48, +48 mixV075 ML-DmBG1-C1SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies S30 s2-48 #2V011 Sg4S20 2-4day pupae#2SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR001664 homozygous dcr-2_untreated V067 S2-NPGSM280082 WT ovaries (18-29nt) V001 IR-GSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) SRR001347 ago2 untreated S26 1st instar #2V008 S2-DRSCS11 2-6h #2 (9)GSM180333 late embryo (12-24) V018 Kc167 cellGSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown GSM180332 mid embryo (6-10) S14 0-1hr #1 (A)GSM180328 adult heads (female heads, male heads) V019 GM2 cellSRR029031 loqs-ORF knockdown S31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes SRR031693_4 SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated V076 ML-DmBG3-C2SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown SRR001349 heterozygous dcr-2_untreated SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM467731 loq GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR029029 dcr-1 knockdown GSM280088 S2cell (AGO1IP) SRR010959 Ago3 IP in heterozygotes GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown GSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated S15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001348 ago2 oxidized SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb V025 S2R+ cellSRR010958 Piwi IP in Ago3 trans-heterozygotes GSM343287 Drosophila Toll 10b mutant embryos SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes SRR001338 IR non-beta-eliminated SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental GSM280083 dcr-2-/- ovaries (18-29nt) SRR032093 ago1 knockdown V024 kc167 cellV033 CMEW1 Cl.8+ cellSRR010951 Ago3 heterozygotes, oxidized SRR010953 Aub heterozygotes, oxidized
....................TTTTCTTAGTCTAATCTAAA..................................................................................................2011000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................AACAAGGTAAATATCAGGTTGT.............................................................................221321004021030112000011000001200000010000000000000000010001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................AACAAGGTAAATATCAGGTTGTT............................................................................231881877472140054131001010010121210002101000000024200000000000000000000100000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................AACAAGGTAAATATCAGGTTG..............................................................................211302310010000100001010000001100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................AACAAGGTAAATATCAGGTT...............................................................................2014400000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................AACAAGGTAAATATCAGGTTGTTT...........................................................................241169236171666411637312314442104051007040204000010100101000010100000001000000001000010001010100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................AACAAGGTAAATATCAGGTTGTTTC..........................................................................2519302323221041363013132021100000000000100100000205000001001100000001000020210100000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................ACAAGGTAAATATCAGGTTGT.............................................................................2111343474111131537612012410100020101000410000002102000000000001002000111000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................ACAAGGTAAATATCAGGTTGTTT...........................................................................23113114057872611151064329383193321310111081010949511685666537963857410031424441412082312300132012000130310000200000001010000110000000101010000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................ACAAGGTAAATATCAGGTTGTTTCC.........................................................................2511010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................ACAAGGTAAATATCAGGT................................................................................1811100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................ACAAGGTAAATATCAGGTTGTT............................................................................221633385132171924243419724245141044241300031000113241402010021002000001011000300000001101000000001000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................ACAAGGTAAATATCAGGTTG..............................................................................201242000010100000000001000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................ACAAGGTAAATATCAGGTT...............................................................................1914300000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................ACAAGGTAAATATCAGGTTGTTTC..........................................................................241159274371571824418445459355419412820271717191213101518791281251186652935270902563655563602442142123223231102003321001111110101111001101111000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................CAAGGTAAATATCAGGTTGT.............................................................................2011100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................CAAGGTAAATATCAGGTTGTT............................................................................2115101000001000000000000000000000000000000010000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................CAAGGTAAATATCAGGTTGTTT...........................................................................22111151300000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................CAAGGTAAATATCAGGTTGTTTC..........................................................................23129197400040000000000100000010000000000000010000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................AAGGTAAATATCAGGTTGT.............................................................................1911000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................AAGGTAAATATCAGGTTGTTTC..........................................................................2213100200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................AAGGTAAATATCAGGTTGTTT...........................................................................2113010000000000000000000000000001000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................GGTAAATATCAGGTTGTTT...........................................................................1911000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................GTAAATATCAGGTTGTTTC..........................................................................1913000000003000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................TAAATATCAGGTTGTTTCC.........................................................................1911000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................TAAATATCAGGTTGTTTC..........................................................................1815000100000100002000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................AAACATCTGTATATACCTTTG........................................2111100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................AACATCTGTATATACCTTTGTTC.....................................2317210000000000000000000000000101001000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................AACATCTGTATATACCTTTGT.......................................21116010000101000000001010100000000000000002100040000000000100001000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................AACATCTGTATATACCTTTGTT......................................221331100001000000010000031200000600005000000000120000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................AACATCTGTATATACCTTTG........................................2011000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................ACATCTGTATATACCTTTGTTC.....................................2218121000010000100000000000010000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................ACATCTGTATATACCTTTG........................................1911000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................ACATCTGTATATACCTTTGTTCC....................................23117332110000020300000100000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
....................................................................................................CCGATTGGACAAAAGTGCGTCTTCTAG...........2711000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                                          SizeBlastTotalGSM280085 WT testes (18-24nt) S21 disk #2S24 male body #2S5 imaginal discV090 CS  male total RNA  V083 male, one dayV097 CS ovaryS9 0-1h #3 (7)V063 CS,ovary,AGO1IPSRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 GSM180335 imaginal discs SRR031697 Total small RNAs from dcr-2 heterozygous flies S32 s2+48 #2S35 KC+48 #2SRR014277 Ovary_rep1 NA_P GSM379057 Krimp Mutant SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR014275 Ovary_rep1 LK_P S19 2-4day pupae #1GSM379061 Squ Heterozygote S28 0-2d pupaeOSS8 Drosophila OSS cell small RNA libraries, rep4 S3 male bodyGSM379065 Zuc Heterozygote V098 dcr-2[L811fsX] ovaryS10 2-6h #1 (8)GSM379051 Armi Mutant OSS6 Drosophila OSS cell small RNA libraries, rep2 S29 male head #1SRR031692 Total small RNAs from Oregon R V065 dcr-2[L811fsX], ovary, AGO1IPS34 KC+48 #1OSS7 Drosophila OSS cell small RNA libraries, rep3 GSM379056 Krimp Heterozygote SRR029633 total small RNAs from hen1 homozygous flies SRR031703 Total small RNAs from r2d2 homozygous flies GSM379066 Zuc Mutant GSM379063 Vasa Heterozygote SRR014280 Ovary_rep1 w1118_P V064 ago2[414], ovary, AGO1IPS23 female body #2V066 r2d2[1], ovary, AGO1IPGSM379055 Flam Mutant SRR031696_2152 SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 V088 r2d2[1] ovary total RNA  OSS2 Drosophila OSS cell small RNA libraries, rep1 S27 0-1d Pupae (w)GSM180329 adult bodies (female bodies, male bodies) GSM379067 SpnE Mutant SRR014282 Ovary_rep1 wK_P SRR031699 Total small RNAs from dcr-2 homozygous flies SRR014273 Ovary_rep1_Har_P GSM379059 SRR029028 untreated (mock) V089 ago2[414] ovary total RNA  GSM379064 Vasa Mutant V082 embryo 14-24hrGSM379060 SpnE Heterozygote SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 S4 female bodyS13 6-10h #2 (11)GSM280084 loqs-/- ovaries (18-29nt) S18 3rd inster #2GSM379052 Aub Heterozygote SRR032095 AGO1 IP dcr2 knockdown GSM379062 Squ Mutant S22 female head #1GSM379058 GSM379050 Armi Heterozygote SRR001345 ago2 non-beta-eliminated V084 female, one daySRR001341 WT_males non-beta-eliminated V010 MLDmD20c5SRR001339 WT_females non-beta-eliminated SRR031701 Total small RNAs from r2d2 heterozygous flies S17 3rd inster #1V081 embryo 2-6hrGSM379053 Aub Mutant SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies S25 1st instar #1S2 female headSRR001346 ago2 beta-eliminated S12 6-10h #1 (10)V002 IR+V009 CMEL1S16 KC -48 #1GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries S7 12-24hr embryoGSM379054 Flam Heterozygote SRR001343 dcr-2 non-beta-eliminated S1 male headGSM467729 WT S33 KC-48 #2GSM180334 larvae: 1st instar and 3rd instars V028 CMEW1 Cl.8+ cellV026 1182-4H cellS8 S2-48,+48, KC-48, +48 mixV075 ML-DmBG1-C1SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies S30 s2-48 #2V011 Sg4S20 2-4day pupae#2SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR001664 homozygous dcr-2_untreated V067 S2-NPGSM280082 WT ovaries (18-29nt) V001 IR-GSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) SRR001347 ago2 untreated S26 1st instar #2V008 S2-DRSCS11 2-6h #2 (9)GSM180333 late embryo (12-24) V018 Kc167 cellGSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown GSM180332 mid embryo (6-10) S14 0-1hr #1 (A)GSM180328 adult heads (female heads, male heads) V019 GM2 cellSRR029031 loqs-ORF knockdown S31 s2+48 #1SRR010957 Aub IP in Ago3 trans-heterozygotes SRR031693_4 SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb SRR010952 Ago3 trans-heterozygotes, oxidized GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day SRR001337 WT_females beta-eliminated V076 ML-DmBG3-C2SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown SRR001349 heterozygous dcr-2_untreated SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells V020 S2R+ cellSRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM467731 loq GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR029029 dcr-1 knockdown GSM280088 S2cell (AGO1IP) SRR010959 Ago3 IP in heterozygotes GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown GSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownV021 ML-DmD21 cellSRR001344 dcr-2 beta-eliminated S15 S2 -48 #1GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001348 ago2 oxidized SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb V025 S2R+ cellSRR010958 Piwi IP in Ago3 trans-heterozygotes GSM343287 Drosophila Toll 10b mutant embryos SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes SRR001338 IR non-beta-eliminated SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental GSM280083 dcr-2-/- ovaries (18-29nt) SRR032093 ago1 knockdown V024 kc167 cellV033 CMEW1 Cl.8+ cellSRR010951 Ago3 heterozygotes, oxidized SRR010953 Aub heterozygotes, oxidized