Page generated on Fri Oct 15 12:01:47 2010

dme-mir-977




dme-mir-977

View dme-mir-977 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-97714816917174406711636611916366406


ATCGCGCCGGGGAATCCCAACACAACGAATCAACAAACAAGGTATGCTTTAGATAACTCGAATATCACATCTTCAGTGTTCGAAATCTGATGAGATATTCACGTTGTCTAAATCATGTTTTGTACGAAACTACAACTAAGATTTCATA
....................................((((..((((.((((((((((..(((((((.((((.................)))).)))))))..)))))))))).))))..)))).........................-30.63
........(((....)))..................((((..((((.((((((((((..(((((((.((((.................)))).)))))))..)))))))))).))))..))))..((((((.......)).))))...-36.13
Sense strand
                                                                                                                                                    SizeBlastTotalGSM280085 WT testes (18-24nt) S21 disk #2S24 male body #2S5 imaginal discS9 0-1h #3 (7)V090 CS  male total RNA  S3 male bodyS35 KC+48 #2S19 2-4day pupae #1GSM180335 imaginal discs S28 0-2d pupaeV083 male, one dayS34 KC+48 #1S32 s2+48 #2V020 S2R+ cellS33 KC-48 #2SRR031697 Total small RNAs from dcr-2 heterozygous flies S27 0-1d Pupae (w)S17 3rd inster #1S10 2-6h #1 (8)SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 S29 male head #1S16 KC -48 #1V081 embryo 2-6hrS13 6-10h #2 (11)S8 S2-48,+48, KC-48, +48 mixS23 female body #2GSM180329 adult bodies (female bodies, male bodies) V021 ML-DmD21 cellS22 female head #1S7 12-24hr embryoS12 6-10h #1 (10)SRR029633 total small RNAs from hen1 homozygous flies V076 ML-DmBG3-C2S18 3rd inster #2SRR031703 Total small RNAs from r2d2 homozygous flies S25 1st instar #1V033 CMEW1 Cl.8+ cellSRR031696_2152 SRR031699 Total small RNAs from dcr-2 homozygous flies V082 embryo 14-24hrGSM379055 Flam Mutant GSM180334 larvae: 1st instar and 3rd instars SRR031692 Total small RNAs from Oregon R V097 CS ovaryS2 female headGSM180336 pupae: 0-1 day, 0-2 day, 2-4 day S20 2-4day pupae#2SRR031701 Total small RNAs from r2d2 heterozygous flies V019 GM2 cellV063 CS,ovary,AGO1IPS4 female bodyS30 s2-48 #2V024 kc167 cellV026 1182-4H cellGSM379059 GSM180333 late embryo (12-24) V018 Kc167 cellGSM379064 Vasa Mutant OSS6 Drosophila OSS cell small RNA libraries, rep2 GSM379058 S26 1st instar #2S11 2-6h #2 (9)GSM180332 mid embryo (6-10) SRR031693_4 SRR001349 heterozygous dcr-2_untreated V066 r2d2[1], ovary, AGO1IPV064 ago2[414], ovary, AGO1IPGSM379065 Zuc Heterozygote S31 s2+48 #1GSM379054 Flam Heterozygote S1 male headSRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies V028 CMEW1 Cl.8+ cellSRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR001664 homozygous dcr-2_untreated GSM379057 Krimp Mutant GSM379066 Zuc Mutant SRR001347 ago2 untreated S14 0-1hr #1 (A)V009 CMEL1SRR001341 WT_males non-beta-eliminated GSM180328 adult heads (female heads, male heads) V088 r2d2[1] ovary total RNA  GSM379050 Armi Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM379063 Vasa Heterozygote GSM379052 Aub Heterozygote SRR014275 Ovary_rep1 LK_P V065 dcr-2[L811fsX], ovary, AGO1IPOSS2 Drosophila OSS cell small RNA libraries, rep1 SRR001343 dcr-2 non-beta-eliminated SRR032095 AGO1 IP dcr2 knockdown OSS7 Drosophila OSS cell small RNA libraries, rep3 S15 S2 -48 #1SRR001339 WT_females non-beta-eliminated GSM379051 Armi Mutant SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb V011 Sg4V025 S2R+ cellGSM379061 Squ Heterozygote SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM343287 Drosophila Toll 10b mutant embryos V001 IR-SRR001338 IR non-beta-eliminated SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 GSM280087 S2cell (AGO2IP) GSM379067 SpnE Mutant GSM280086 WT ovaries (AGO2IP) SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 V008 S2-DRSCSRR014282 Ovary_rep1 wK_P SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown V002 IR+OSS8 Drosophila OSS cell small RNA libraries, rep4 V098 dcr-2[L811fsX] ovaryGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown SRR010957 Aub IP in Ago3 trans-heterozygotes SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379056 Krimp Heterozygote SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells SRR001345 ago2 non-beta-eliminated SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM280084 loqs-/- ovaries (18-29nt) GSM467731 loq GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM467729 WT SRR014273 Ovary_rep1_Har_P V089 ago2[414] ovary total RNA  GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR029029 dcr-1 knockdown GSM280088 S2cell (AGO1IP) SRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown SRR014277 Ovary_rep1 NA_P GSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownSRR001344 dcr-2 beta-eliminated GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001348 ago2 oxidized V075 ML-DmBG1-C1SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb GSM379062 Squ Mutant SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR010958 Piwi IP in Ago3 trans-heterozygotes V067 S2-NPGSM280082 WT ovaries (18-29nt) SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes GSM379060 SpnE Heterozygote SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental GSM280083 dcr-2-/- ovaries (18-29nt) SRR029028 untreated (mock) SRR032093 ago1 knockdown SRR001346 ago2 beta-eliminated V084 female, one daySRR010951 Ago3 heterozygotes, oxidized SRR010953 Aub heterozygotes, oxidized
.............................TCAACAAACAAGGTATGCTT...................................................................................................2016400000000101000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................TCAACAAACAAGGTATGC.....................................................................................................1811100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................CAACAAACAAGGTATGCTT...................................................................................................191644820003000001010000001002000001000100000000001000010000000000000000000000000000000000000000000000100000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................AACAAACAAGGTATGCTT...................................................................................................1812000001000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................TAGATAACTCGAATATCACATC.............................................................................2212201022971506171323610183003102000010010203010200010000001000000021000001000000010001000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................TAGATAACTCGAATATCACAT..............................................................................211134661016982420200420440000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................TAGATAACTCGAATATCAC................................................................................1913100000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................TAGATAACTCGAATATCACATCTTC..........................................................................2512000000000000000010000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................TAGATAACTCGAATATCACA...............................................................................2014461100012602100001200000000010000100000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................GATAACTCGAATATCACATC.............................................................................2012011000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...................................................GATAACTCGAATATCACAT..............................................................................1911100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.......................................................................TTCAGTGTTCGAAATCTGA..........................................................1917111991043031004010010006000001000101100010011000000000000000000000000000001000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................................................................ATGAGATATTCACGTTGTCTA......................................21110900000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................................................................ATGAGATATTCACGTTGTCT.......................................2013000000000000001000000000000000000000000000000000000000000000000000000000000000000100000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................................................................ATGAGATATTCACGTTGTCTAAA....................................2316130100000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................................................................ATGAGATATTCACGTTGTCTAA.....................................2217022200000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................................................................TGAGATATTCACGTTGTCTAAAT...................................231161032000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................................................................TGAGATATTCACGTTGTCT.......................................191620544311115225110145011653121148220100900040242102725071215000002164105340411100000010010000010101000100100000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................................................................TGAGATATTCACGTTGTCTA......................................2012526177213818952863829261410623101421714063414132044203135111022200020100100111000010000011001000000000010000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................................................................TGAGATATTCACGTTGTCTAA.....................................21184363191150410087465417218613414812910442102961461162424953117281714200101315171814263421763100310201000033100001001000010000010000000010100001001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................................................................TGAGATATTCACGTTGTCTAAA....................................22146962811373323321130132302334534969172026402020625033322847064142255514221645113201140013001100221320210202201000001001011100010010010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................................................................TGAGATATTCACGTTGTC........................................181191010101000001000000000010000000003000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................................................................GAGATATTCACGTTGTCTAA.....................................2017132100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................................................................GAGATATTCACGTTGTCT.......................................1812000000000000000000000000000000000000000000000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................................................................GAGATATTCACGTTGTCTA......................................1915000000100000300000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................................................................GAGATATTCACGTTGTCTAAA....................................2115220000000000000000000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................................................................AGATATTCACGTTGTCTAA.....................................1914100000000000000010000000002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................................GATATTCACGTTGTCTAAA....................................1911100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................................ATATTCACGTTGTCTAAA....................................1813300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................................................................................................TCATGTTTTGTACGAAACT.................1911000000000000000000000000000000000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                                                    SizeBlastTotalGSM280085 WT testes (18-24nt) S21 disk #2S24 male body #2S5 imaginal discS9 0-1h #3 (7)V090 CS  male total RNA  S3 male bodyS35 KC+48 #2S19 2-4day pupae #1GSM180335 imaginal discs S28 0-2d pupaeV083 male, one dayS34 KC+48 #1S32 s2+48 #2V020 S2R+ cellS33 KC-48 #2SRR031697 Total small RNAs from dcr-2 heterozygous flies S27 0-1d Pupae (w)S17 3rd inster #1S10 2-6h #1 (8)SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 S29 male head #1S16 KC -48 #1V081 embryo 2-6hrS13 6-10h #2 (11)S8 S2-48,+48, KC-48, +48 mixS23 female body #2GSM180329 adult bodies (female bodies, male bodies) V021 ML-DmD21 cellS22 female head #1S7 12-24hr embryoS12 6-10h #1 (10)SRR029633 total small RNAs from hen1 homozygous flies V076 ML-DmBG3-C2S18 3rd inster #2SRR031703 Total small RNAs from r2d2 homozygous flies S25 1st instar #1V033 CMEW1 Cl.8+ cellSRR031696_2152 SRR031699 Total small RNAs from dcr-2 homozygous flies V082 embryo 14-24hrGSM379055 Flam Mutant GSM180334 larvae: 1st instar and 3rd instars SRR031692 Total small RNAs from Oregon R V097 CS ovaryS2 female headGSM180336 pupae: 0-1 day, 0-2 day, 2-4 day S20 2-4day pupae#2SRR031701 Total small RNAs from r2d2 heterozygous flies V019 GM2 cellV063 CS,ovary,AGO1IPS4 female bodyS30 s2-48 #2V024 kc167 cellV026 1182-4H cellGSM379059 GSM180333 late embryo (12-24) V018 Kc167 cellGSM379064 Vasa Mutant OSS6 Drosophila OSS cell small RNA libraries, rep2 GSM379058 S26 1st instar #2S11 2-6h #2 (9)GSM180332 mid embryo (6-10) SRR031693_4 SRR001349 heterozygous dcr-2_untreated V066 r2d2[1], ovary, AGO1IPV064 ago2[414], ovary, AGO1IPGSM379065 Zuc Heterozygote S31 s2+48 #1GSM379054 Flam Heterozygote S1 male headSRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies V028 CMEW1 Cl.8+ cellSRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR001664 homozygous dcr-2_untreated GSM379057 Krimp Mutant GSM379066 Zuc Mutant SRR001347 ago2 untreated S14 0-1hr #1 (A)V009 CMEL1SRR001341 WT_males non-beta-eliminated GSM180328 adult heads (female heads, male heads) V088 r2d2[1] ovary total RNA  GSM379050 Armi Heterozygote SRR010952 Ago3 trans-heterozygotes, oxidized GSM379063 Vasa Heterozygote GSM379052 Aub Heterozygote SRR014275 Ovary_rep1 LK_P V065 dcr-2[L811fsX], ovary, AGO1IPOSS2 Drosophila OSS cell small RNA libraries, rep1 SRR001343 dcr-2 non-beta-eliminated SRR032095 AGO1 IP dcr2 knockdown OSS7 Drosophila OSS cell small RNA libraries, rep3 S15 S2 -48 #1SRR001339 WT_females non-beta-eliminated GSM379051 Armi Mutant SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb V011 Sg4V025 S2R+ cellGSM379061 Squ Heterozygote SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 GSM343287 Drosophila Toll 10b mutant embryos V001 IR-SRR001338 IR non-beta-eliminated SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 GSM280087 S2cell (AGO2IP) GSM379067 SpnE Mutant GSM280086 WT ovaries (AGO2IP) SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 V008 S2-DRSCSRR014282 Ovary_rep1 wK_P SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM239051 S2 cells, beta-eliminated SRR032094 ago2 knockdown V002 IR+OSS8 Drosophila OSS cell small RNA libraries, rep4 V098 dcr-2[L811fsX] ovaryGSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR029031 loqs-ORF knockdown SRR010957 Aub IP in Ago3 trans-heterozygotes SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb GSM379056 Krimp Heterozygote SRR001337 WT_females beta-eliminated SRR023197 RNA Library from S2 control cells SRR032092 mock oxidized SRR029033 lacZ knockdown V010 MLDmD20c5SRR010956 Piwi IP in Ago3 heterozygotes GSM424740 S2 pKF63 stably transfected SRR010954 Aub trans-heterozygotes, oxidized SRR023400 total RNA extracted from P19 cells SRR001345 ago2 non-beta-eliminated SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb SRR023407 RNA bound by NLS-P19 protein GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR023402 total RNA extracted from NLS-P19 cells SRR001340 IR beta-eliminated GSM280084 loqs-/- ovaries (18-29nt) GSM467731 loq GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries GSM467729 WT SRR014273 Ovary_rep1_Har_P V089 ago2[414] ovary total RNA  GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM379053 Aub Mutant SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR029029 dcr-1 knockdown GSM280088 S2cell (AGO1IP) SRR010959 Ago3 IP in heterozygotes SRR014280 Ovary_rep1 w1118_P GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown SRR014277 Ovary_rep1 NA_P GSM180330 very early embryo (0-1) GSM424741 S2 pKF63 transiently transfected SRR032096 AGO2 IP dcr2 knockdownSRR001344 dcr-2 beta-eliminated GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001348 ago2 oxidized V075 ML-DmBG1-C1SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb GSM379062 Squ Mutant SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR010958 Piwi IP in Ago3 trans-heterozygotes V067 S2-NPGSM280082 WT ovaries (18-29nt) SRR023399 RNA bound by P19 protein SRR010955 Aub IP in Ago3 heterozygotes GSM379060 SpnE Heterozygote SRR029030 dcr-2 knockdown GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 GSM239041 fly heads, non beta-eliminated GSM424739 S2 parental GSM280083 dcr-2-/- ovaries (18-29nt) SRR029028 untreated (mock) SRR032093 ago1 knockdown SRR001346 ago2 beta-eliminated V084 female, one daySRR010951 Ago3 heterozygotes, oxidized SRR010953 Aub heterozygotes, oxidized
.............ATCCCAACACAACGAATCAACAAA...............................................................................................................2411000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000