Page generated on Fri Oct 15 12:01:40 2010

dme-mir-983-2




dme-mir-983-2

View dme-mir-983-2 on miRBase
miRNALengthPerfect(sense)Perfect(antisense)5' moR5'armLoop3'arm3' moROtherLoop SizeMatureStar
dme-mir-983-214882299602617272062712146172720627


TAGATTCGTATTATATGCATATGCTATTATATTGCAATAATTAAATAATACGTTTCGAACTAATGATTTTCAGTTCATTCATTAGGTAGTTACGCATTATCTAGTTGTTGTAAACATTCAACTCGATGGCGGATGAGAAATTACTTAT
...............................((((((((((((.(((((.(((..(...(((((((............)))))))...)..))).))))).))))))))))))...................................-25.00
.......(((.......(((.(((((((...((((((((((((.(((((.(((..(...(((((((............)))))))...)..))).))))).))))))))))))...........))))))).)))......)))....-31.76
Sense strand
                                                                                                                                                    SizeBlastTotalV076 ML-DmBG3-C2GSM280085 WT testes (18-24nt) V065 dcr-2[L811fsX], ovary, AGO1IPV098 dcr-2[L811fsX] ovaryV081 embryo 2-6hrV097 CS ovaryV082 embryo 14-24hrV090 CS  male total RNA  V066 r2d2[1], ovary, AGO1IPV024 kc167 cellV084 female, one dayS21 disk #2GSM280082 WT ovaries (18-29nt) V063 CS,ovary,AGO1IPV088 r2d2[1] ovary total RNA  V018 Kc167 cellV083 male, one dayGSM379065 Zuc Heterozygote SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 SRR031697 Total small RNAs from dcr-2 heterozygous flies S5 imaginal discSRR014280 Ovary_rep1 w1118_P S24 male body #2V089 ago2[414] ovary total RNA  SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 V026 1182-4H cellGSM379057 Krimp Mutant V064 ago2[414], ovary, AGO1IPV021 ML-DmD21 cellGSM379066 Zuc Mutant OSS2 Drosophila OSS cell small RNA libraries, rep1 SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 OSS8 Drosophila OSS cell small RNA libraries, rep4 S9 0-1h #3 (7)SRR014282 Ovary_rep1 wK_P OSS6 Drosophila OSS cell small RNA libraries, rep2 SRR010954 Aub trans-heterozygotes, oxidized OSS7 Drosophila OSS cell small RNA libraries, rep3 V009 CMEL1SRR010953 Aub heterozygotes, oxidized SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM379067 SpnE Mutant GSM180335 imaginal discs GSM379064 Vasa Mutant SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb V075 ML-DmBG1-C1V008 S2-DRSCGSM379062 Squ Mutant S32 s2+48 #2V010 MLDmD20c5SRR014277 Ovary_rep1 NA_P GSM379063 Vasa Heterozygote SRR031699 Total small RNAs from dcr-2 homozygous flies S27 0-1d Pupae (w)S28 0-2d pupaeGSM379056 Krimp Heterozygote S33 KC-48 #2SRR031692 Total small RNAs from Oregon R GSM379058 SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR029028 untreated (mock) SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb SRR031696_2152 GSM379052 Aub Heterozygote SRR014275 Ovary_rep1 LK_P S35 KC+48 #2SRR029633 total small RNAs from hen1 homozygous flies SRR031703 Total small RNAs from r2d2 homozygous flies V067 S2-NPS29 male head #1GSM379051 Armi Mutant GSM379061 Squ Heterozygote V001 IR-SRR014273 Ovary_rep1_Har_P S19 2-4day pupae #1S13 6-10h #2 (11)GSM280083 dcr-2-/- ovaries (18-29nt) S31 s2+48 #1GSM379054 Flam Heterozygote GSM379060 SpnE Heterozygote SRR031701 Total small RNAs from r2d2 heterozygous flies SRR023400 total RNA extracted from P19 cells SRR029030 dcr-2 knockdown SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb GSM280084 loqs-/- ovaries (18-29nt) GSM379053 Aub Mutant V019 GM2 cellSRR023197 RNA Library from S2 control cells S3 male bodyGSM379055 Flam Mutant GSM379059 V033 CMEW1 Cl.8+ cellS12 6-10h #1 (10)S16 KC -48 #1GSM379050 Armi Heterozygote SRR032095 AGO1 IP dcr2 knockdown GSM280088 S2cell (AGO1IP) V011 Sg4V002 IR+SRR010958 Piwi IP in Ago3 trans-heterozygotes V028 CMEW1 Cl.8+ cellSRR010959 Ago3 IP in heterozygotes S10 2-6h #1 (8)V025 S2R+ cellS11 2-6h #2 (9)S34 KC+48 #1S17 3rd inster #1SRR032094 ago2 knockdown SRR001349 heterozygous dcr-2_untreated S15 S2 -48 #1SRR029031 loqs-ORF knockdown S23 female body #2S18 3rd inster #2SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR023399 RNA bound by P19 protein SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb SRR010955 Aub IP in Ago3 heterozygotes GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day V020 S2R+ cellSRR001343 dcr-2 non-beta-eliminated S8 S2-48,+48, KC-48, +48 mixS22 female head #1S14 0-1hr #1 (A)S4 female bodySRR010957 Aub IP in Ago3 trans-heterozygotes SRR010956 Piwi IP in Ago3 heterozygotes SRR023407 RNA bound by NLS-P19 protein SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies GSM180334 larvae: 1st instar and 3rd instars S25 1st instar #1GSM180330 very early embryo (0-1) S20 2-4day pupae#2S2 female headGSM180329 adult bodies (female bodies, male bodies) S26 1st instar #2SRR001341 WT_males non-beta-eliminated GSM180328 adult heads (female heads, male heads) S7 12-24hr embryoSRR010952 Ago3 trans-heterozygotes, oxidized SRR001345 ago2 non-beta-eliminated SRR023402 total RNA extracted from NLS-P19 cells GSM467731 loq GSM467729 WT SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR032096 AGO2 IP dcr2 knockdownSRR001339 WT_females non-beta-eliminated S30 s2-48 #2SRR001664 homozygous dcr-2_untreated SRR001338 IR non-beta-eliminated GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 GSM239041 fly heads, non beta-eliminated SRR010951 Ago3 heterozygotes, oxidized GSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) SRR001347 ago2 untreated GSM180333 late embryo (12-24) GSM239051 S2 cells, beta-eliminated GSM180332 mid embryo (6-10) GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR031693_4 SRR001337 WT_females beta-eliminated SRR032092 mock oxidized SRR029033 lacZ knockdown GSM424740 S2 pKF63 stably transfected GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR001340 IR beta-eliminated GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries S1 male headGSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR029029 dcr-1 knockdown GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown GSM424741 S2 pKF63 transiently transfected SRR001344 dcr-2 beta-eliminated GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001348 ago2 oxidized GSM343287 Drosophila Toll 10b mutant embryos GSM424739 S2 parental SRR032093 ago1 knockdown SRR001346 ago2 beta-eliminated
.........................ATTATATTGCAATAATTAA........................................................................................................1922200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................TAAATAATACGTTTCGAAC........................................................................................1921100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................AAATAATACGTTTCGAACT.......................................................................................1921000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACTAATGA..................................................................................232211602000200000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACTA......................................................................................1921000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACTAA.....................................................................................2021100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACTAATG...................................................................................222211500020000000110000000000000000000100000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACTAAT....................................................................................212272400000200100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACT.......................................................................................1823000000000000000000000000000000000000000030000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................ATAATACGTTTCGAACTAATG...................................................................................2121420311591148206167212951978044118299134583910948452367241640151336383917401123830133319818136315565514671584111810108113036293448666233612433320733443345032002005041411021212422001300010000102010001000110010100000000000000000000000000000000000000000
............................................ATAATACGTTTCGAACTAAT....................................................................................202121791151016702450143436115126325432162311006127240131201511163813991600403380062030040403140801215620000101000303010201110010021001000000022010000000000000000000000000000000000000000000000000000000000000000000000000000
............................................ATAATACGTTTCGAACTAATGA..................................................................................222332572490813311349687996475162583091532551291191602491441241671448467131441031027036736965504263358383563839540301731343222191921232313111316991822413131510131486127978879851355847936255450352103916314101001030412000002221110001000001001100011001010000000000000000000000000000000000
............................................ATAATACGTTTCGAACTAATGAT.................................................................................232362214103001001200000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................ATAATACGTTTCGAACTA......................................................................................182120570002102000000000000100000100000000003300220000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
............................................ATAATACGTTTCGAACTAA.....................................................................................19297991943311021700020600020000014102010100130131000001000000000020000110010100000000000000000000000000001000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................TAATACGTTTCGAACTAATGATT................................................................................2321100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................TAATACGTTTCGAACTAAT....................................................................................192494300100001001000000000000001001000000000000000000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................TAATACGTTTCGAACTAATGAT.................................................................................22217615301100111101001000000000000010000180000000000100001000000000000000000000101000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000
.............................................TAATACGTTTCGAACTAATG...................................................................................2021129330100001102000100010000000000000000000010000000000000100000000000000000000000000020002000000000000000000001000000001000000000000000000000000000000000000100000000000000000000000000000000000
.............................................TAATACGTTTCGAACTAA.....................................................................................1821100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................TAATACGTTTCGAACTAATGA..................................................................................21248640337695242413632023001300111201000000000000000000000010000300040000000001000000000000001010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................AATACGTTTCGAACTAATGA..................................................................................20213800002000001000100000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................AATACGTTTCGAACTAAT....................................................................................1827700000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................AATACGTTTCGAACTAATG...................................................................................1928210110000001000000010000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................ATACGTTTCGAACTAATGA..................................................................................1925500000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................................TACGTTTCGAACTAATGA..................................................................................1822200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................CATTAGGTAGTTACGCATTATCT..............................................2327401000001000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................CATTAGGTAGTTACGCATTATC...............................................2222100000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................CATTAGGTAGTTACGCATTAT................................................2122200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................................................................ATTAGGTAGTTACGCATT..................................................182342030040010000100110000000000000000000010010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000
................................................................................ATTAGGTAGTTACGCATTAT................................................20212526543861922438122873321804160011040033120010130000000000010000011000000000000000200001020000002000000000000310000000000000200000000000000000000000000000000000000000000000000000000000000000000000000000
................................................................................ATTAGGTAGTTACGCATTATCT..............................................22215283662151324414394092381227612279116982231265933534950394929463729152219271038925617470340121215171284191111111822223501461254374666115349468607436102343803251700011030521001101000011110000000010110010000000000110000000000000000000000000000000000000
................................................................................ATTAGGTAGTTACGCATTATCTA.............................................232145129128000200265100010118070000000000090000011070100010000440000000000201000000100000000000001000001000000030000000000000000011100000010200000000000000000000000000000000000000000000000000000000
................................................................................ATTAGGTAGTTACGCATTATC...............................................21232131781664521031804776491662011121381732510313612015174530170250143101030100000041001324200000002012110300000000000010000200000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000
................................................................................ATTAGGTAGTTACGCATTA.................................................1928046201131041000100100000000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................TTAGGTAGTTACGCATTATCTA.............................................22224020000000005000000006030000000000010000000030000000010010000000000000000000100000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................TTAGGTAGTTACGCATTAT................................................192171040000000100000100000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................TTAGGTAGTTACGCATTATC...............................................2026225280111010100000100000010000000000000000000000000000000000000000000000000000000000000000000000000200000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.................................................................................TTAGGTAGTTACGCATTATCT..............................................2124571271553024000134572000001220170000000150280201000060000160000020501000600200000000040100200010003000010000000000020001011000010000000000000001000100000000000000000000000000000000000000000000000000
.................................................................................TTAGGTAGTTACGCATTA.................................................1822100000000000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..................................................................................TAGGTAGTTACGCATTATCT..............................................2025210000000002000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
......................................................................................TAGTTACGCATTATCTAGTTG.........................................2121000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
....................................................................................................................TTCAACTCGATGGCGGATGAGAAAT.......2511000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
Antisense strand
                                                                                                                                                    SizeBlastTotalV076 ML-DmBG3-C2GSM280085 WT testes (18-24nt) V065 dcr-2[L811fsX], ovary, AGO1IPV098 dcr-2[L811fsX] ovaryV081 embryo 2-6hrV097 CS ovaryV082 embryo 14-24hrV090 CS  male total RNA  V066 r2d2[1], ovary, AGO1IPV024 kc167 cellV084 female, one dayS21 disk #2GSM280082 WT ovaries (18-29nt) V063 CS,ovary,AGO1IPV088 r2d2[1] ovary total RNA  V018 Kc167 cellV083 male, one dayGSM379065 Zuc Heterozygote SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1 SRR031697 Total small RNAs from dcr-2 heterozygous flies S5 imaginal discSRR014280 Ovary_rep1 w1118_P S24 male body #2V089 ago2[414] ovary total RNA  SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1 SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1 V026 1182-4H cellGSM379057 Krimp Mutant V064 ago2[414], ovary, AGO1IPV021 ML-DmD21 cellGSM379066 Zuc Mutant OSS2 Drosophila OSS cell small RNA libraries, rep1 SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1 OSS8 Drosophila OSS cell small RNA libraries, rep4 S9 0-1h #3 (7)SRR014282 Ovary_rep1 wK_P OSS6 Drosophila OSS cell small RNA libraries, rep2 SRR010954 Aub trans-heterozygotes, oxidized OSS7 Drosophila OSS cell small RNA libraries, rep3 V009 CMEL1SRR010953 Aub heterozygotes, oxidized SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1 GSM379067 SpnE Mutant GSM180335 imaginal discs GSM379064 Vasa Mutant SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb V075 ML-DmBG1-C1V008 S2-DRSCGSM379062 Squ Mutant S32 s2+48 #2V010 MLDmD20c5SRR014277 Ovary_rep1 NA_P GSM379063 Vasa Heterozygote SRR031699 Total small RNAs from dcr-2 homozygous flies S27 0-1d Pupae (w)S28 0-2d pupaeGSM379056 Krimp Heterozygote S33 KC-48 #2SRR031692 Total small RNAs from Oregon R GSM379058 SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb SRR029028 untreated (mock) SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb SRR031696_2152 GSM379052 Aub Heterozygote SRR014275 Ovary_rep1 LK_P S35 KC+48 #2SRR029633 total small RNAs from hen1 homozygous flies SRR031703 Total small RNAs from r2d2 homozygous flies V067 S2-NPS29 male head #1GSM379051 Armi Mutant GSM379061 Squ Heterozygote V001 IR-SRR014273 Ovary_rep1_Har_P S19 2-4day pupae #1S13 6-10h #2 (11)GSM280083 dcr-2-/- ovaries (18-29nt) S31 s2+48 #1GSM379054 Flam Heterozygote GSM379060 SpnE Heterozygote SRR031701 Total small RNAs from r2d2 heterozygous flies SRR023400 total RNA extracted from P19 cells SRR029030 dcr-2 knockdown SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb GSM280084 loqs-/- ovaries (18-29nt) GSM379053 Aub Mutant V019 GM2 cellSRR023197 RNA Library from S2 control cells S3 male bodyGSM379055 Flam Mutant GSM379059 V033 CMEW1 Cl.8+ cellS12 6-10h #1 (10)S16 KC -48 #1GSM379050 Armi Heterozygote SRR032095 AGO1 IP dcr2 knockdown GSM280088 S2cell (AGO1IP) V011 Sg4V002 IR+SRR010958 Piwi IP in Ago3 trans-heterozygotes V028 CMEW1 Cl.8+ cellSRR010959 Ago3 IP in heterozygotes S10 2-6h #1 (8)V025 S2R+ cellS11 2-6h #2 (9)S34 KC+48 #1S17 3rd inster #1SRR032094 ago2 knockdown SRR001349 heterozygous dcr-2_untreated S15 S2 -48 #1SRR029031 loqs-ORF knockdown S23 female body #2S18 3rd inster #2SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies SRR023399 RNA bound by P19 protein SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb SRR010955 Aub IP in Ago3 heterozygotes GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day V020 S2R+ cellSRR001343 dcr-2 non-beta-eliminated S8 S2-48,+48, KC-48, +48 mixS22 female head #1S14 0-1hr #1 (A)S4 female bodySRR010957 Aub IP in Ago3 trans-heterozygotes SRR010956 Piwi IP in Ago3 heterozygotes SRR023407 RNA bound by NLS-P19 protein SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies GSM180334 larvae: 1st instar and 3rd instars S25 1st instar #1GSM180330 very early embryo (0-1) S20 2-4day pupae#2S2 female headGSM180329 adult bodies (female bodies, male bodies) S26 1st instar #2SRR001341 WT_males non-beta-eliminated GSM180328 adult heads (female heads, male heads) S7 12-24hr embryoSRR010952 Ago3 trans-heterozygotes, oxidized SRR001345 ago2 non-beta-eliminated SRR023402 total RNA extracted from NLS-P19 cells GSM467731 loq GSM467729 WT SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies SRR032096 AGO2 IP dcr2 knockdownSRR001339 WT_females non-beta-eliminated S30 s2-48 #2SRR001664 homozygous dcr-2_untreated SRR001338 IR non-beta-eliminated GSM239052 S2 cells, non beta-eliminated GSM467730 r2d2 GSM239041 fly heads, non beta-eliminated SRR010951 Ago3 heterozygotes, oxidized GSM280087 S2cell (AGO2IP) GSM280086 WT ovaries (AGO2IP) SRR001347 ago2 untreated GSM180333 late embryo (12-24) GSM239051 S2 cells, beta-eliminated GSM180332 mid embryo (6-10) GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries SRR031693_4 SRR001337 WT_females beta-eliminated SRR032092 mock oxidized SRR029033 lacZ knockdown GSM424740 S2 pKF63 stably transfected GSM180337 tissue culture cells (S2 only) SRR010960 wt, oxidized SRR001340 IR beta-eliminated GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries S1 male headGSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries SRR001342 WT_males beta-eliminated GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006) GSM246084 D. melanogaster adult male heads 454 GSM239050 fly heads, beta-eliminated SRR029029 dcr-1 knockdown GSM180331 early embryo (2-6) SRR029032 r2d2 knockdown GSM424741 S2 pKF63 transiently transfected SRR001344 dcr-2 beta-eliminated GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0 SRR001348 ago2 oxidized GSM343287 Drosophila Toll 10b mutant embryos GSM424739 S2 parental SRR032093 ago1 knockdown SRR001346 ago2 beta-eliminated
.......................................ATTAAATAATACGTTTCGAACTA......................................................................................2321000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................TTAAATAATACGTTTCGAACTA......................................................................................2223000100000100000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.........................................TAAATAATACGTTTCGAACTAA.....................................................................................2221000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................AAATAATACGTTTCGAACTAAT....................................................................................2221000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000
..........................................AAATAATACGTTTCGAACTAA.....................................................................................2122000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................AAATAATACGTTTCGAACTA......................................................................................2022000000000000000000010000000000000000000000000000000000000000000000010000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACTA......................................................................................1922000000000000000000010000000000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACTAAT....................................................................................2124000100000000002000000000000000000000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...........................................AATAATACGTTTCGAACTAATG...................................................................................2221000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................TTCATTAGGTAGTTACGCATTAT................................................2321000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
.............................................................................TTCATTAGGTAGTTACGCATTA.................................................2221000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..............................................................................TCATTAGGTAGTTACGCATTA.................................................21210000101000100001001000000000000000000000000000000000000000000000000000000000000010000000000000020001000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000
..............................................................................TCATTAGGTAGTTACGCATTAT................................................2223000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000020000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................CATTAGGTAGTTACGCATTATCT..............................................2321000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................CATTAGGTAGTTACGCATTAT................................................2128000002000000001002200000000000000000000000001000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
...............................................................................CATTAGGTAGTTACGCATTA.................................................2022000000000000000000000000000000000000000000000000000000000000000000000000100000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
................................................................................ATTAGGTAGTTACGCATTATCT..............................................22215001200000000002000000020021000000000000000000000000000000401000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
........................................................................................GTTACGCATTATCTAGTT..........................................1821000000000000000000000000000000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
..........................................................................................TACGCATTATCTAGTTGTTGT.....................................2121000000100000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000