Page generated on Fri Oct 15 12:01:50 2010

dme-mir-991



dme-mir-991

View dme-mir-991 on miRBase

miRNA	Length	Perfect(sense)	Perfect(antisense)	5' moR	5'arm	Loop	3'arm	3' moR	Other	Loop Size	Mature	Star
dme-mir-991	145	3603			15		3587	1		18	3587	15

GTTACCTGCGTAGGATATCAAAACTATCACTGCAGTTTCAGGCTTTTCCCAACTACACCTATTAATACATATTTTAACGTCCTATTAAAGTTGTAGTTTGGAAAGTTTTGGTTTTGCATTAGAAATCGCCACTCAACTTGGTTTT
..............................(((((..(((((.((((((.(((((((.((.((((((...............)))))))).))))))).)))))).)))))..)))))...........................-25.46
....(((....))).........(((....(((((..(((((.((((((.(((((((.((.((((((...............)))))))).))))))).)))))).)))))..))))).))).....((((.......))))...-29.96
Sense strand

	Size	Blast	Total	V090 CS  male total RNA	V081 embryo 2-6hr	V083 male, one day	V098 dcr-2[L811fsX] ovary	V066 r2d2[1], ovary, AGO1IP	V064 ago2[414], ovary, AGO1IP	SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1	GSM280085 WT testes (18-24nt)	S21 disk #2	V065 dcr-2[L811fsX], ovary, AGO1IP	V088 r2d2[1] ovary total RNA	S5 imaginal disc	V097 CS ovary	V019 GM2 cell	V082 embryo 14-24hr	SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1	S24 male body #2	V089 ago2[414] ovary total RNA	SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1	SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies	V063 CS,ovary,AGO1IP	SRR014277 Ovary_rep1 NA_P	V084 female, one day	SRR014273 Ovary_rep1_Har_P	SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies	SRR014280 Ovary_rep1 w1118_P	GSM379051 Armi Mutant	S9 0-1h #3 (7)	GSM379057 Krimp Mutant	GSM379061 Squ Heterozygote	GSM180335 imaginal discs	SRR014275 Ovary_rep1 LK_P	SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1	S28 0-2d pupae	GSM379063 Vasa Heterozygote	SRR014282 Ovary_rep1 wK_P	SRR031697 Total small RNAs from dcr-2 heterozygous flies	GSM379065 Zuc Heterozygote	GSM379059	S19 2-4day pupae #1	S27 0-1d Pupae (w)	GSM379055 Flam Mutant	SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb	V001 IR-	GSM379067 SpnE Mutant	GSM379054 Flam Heterozygote	V009 CMEL1	GSM379056 Krimp Heterozygote	GSM379064 Vasa Mutant	SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1	SRR029633 total small RNAs from hen1 homozygous flies	SRR032094 ago2 knockdown	SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb	SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb	SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb	SRR001349 heterozygous dcr-2_untreated	GSM379052 Aub Heterozygote	SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies	V011 Sg4	GSM343287 Drosophila Toll 10b mutant embryos	GSM379050 Armi Heterozygote	S10 2-6h #1 (8)	S12 6-10h #1 (10)	GSM379066 Zuc Mutant	GSM379058	V002 IR+	GSM280084 loqs-/- ovaries (18-29nt)	V075 ML-DmBG1-C1	GSM379062 Squ Mutant	SRR031692 Total small RNAs from Oregon R	SRR031703 Total small RNAs from r2d2 homozygous flies	S34 KC+48 #1	V026 1182-4H cell	GSM280082 WT ovaries (18-29nt)	GSM379060 SpnE Heterozygote	GSM280083 dcr-2-/- ovaries (18-29nt)	S35 KC+48 #2	SRR031699 Total small RNAs from dcr-2 homozygous flies	S14 0-1hr #1 (A)	S32 s2+48 #2	SRR031693_4	SRR010960 wt, oxidized	GSM379053 Aub Mutant	S3 male body	SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb	SRR032093 ago1 knockdown	V024 kc167 cell	SRR010951 Ago3 heterozygotes, oxidized	S17 3rd inster #1	SRR001347 ago2 untreated	S7 12-24hr embryo	S13 6-10h #2 (11)	SRR010952 Ago3 trans-heterozygotes, oxidized	V076 ML-DmBG3-C2	S18 3rd inster #2	SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies	S20 2-4day pupae#2	SRR001664 homozygous dcr-2_untreated	SRR010958 Piwi IP in Ago3 trans-heterozygotes	V033 CMEW1 Cl.8+ cell	V008 S2-DRSC	V018 Kc167 cell	OSS8 Drosophila OSS cell small RNA libraries, rep4	SRR001341 WT_males non-beta-eliminated	SRR029031 loqs-ORF knockdown	GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day	V010 MLDmD20c5	SRR010954 Aub trans-heterozygotes, oxidized	OSS2 Drosophila OSS cell small RNA libraries, rep1	SRR001343 dcr-2 non-beta-eliminated	GSM280088 S2cell (AGO1IP)	S8 S2-48,+48, KC-48, +48 mix	OSS7 Drosophila OSS cell small RNA libraries, rep3	V021 ML-DmD21 cell	SRR001339 WT_females non-beta-eliminated	SRR001338 IR non-beta-eliminated	OSS6 Drosophila OSS cell small RNA libraries, rep2	S2 female head	GSM180329 adult bodies (female bodies, male bodies)	SRR010953 Aub heterozygotes, oxidized	GSM280087 S2cell (AGO2IP)	GSM280086 WT ovaries (AGO2IP)	S29 male head #1	S26 1st instar #2	S11 2-6h #2 (9)	GSM180333 late embryo (12-24)	GSM239051 S2 cells, beta-eliminated	GSM180332 mid embryo (6-10)	S16 KC -48 #1	GSM180328 adult heads (female heads, male heads)	S4 female body	GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries	S31 s2+48 #1	SRR010957 Aub IP in Ago3 trans-heterozygotes	SRR001337 WT_females beta-eliminated	SRR023197 RNA Library from S2 control cells	SRR032092 mock oxidized	S23 female body #2	SRR029033 lacZ knockdown	SRR010956 Piwi IP in Ago3 heterozygotes	GSM424740 S2 pKF63 stably transfected	SRR023400 total RNA extracted from P19 cells	SRR001345 ago2 non-beta-eliminated	V020 S2R+ cell	SRR023407 RNA bound by NLS-P19 protein	GSM180337 tissue culture cells (S2 only)	SRR023402 total RNA extracted from NLS-P19 cells	SRR001340 IR beta-eliminated	GSM467731 loq	GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries	S1 male head	GSM467729 WT	GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries	SRR001342 WT_males beta-eliminated	GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries	S33 KC-48 #2	GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006)	GSM246084 D. melanogaster adult male heads 454	GSM239050 fly heads, beta-eliminated	SRR032095 AGO1 IP dcr2 knockdown	SRR029029 dcr-1 knockdown	GSM180334 larvae: 1st instar and 3rd instars	V028 CMEW1 Cl.8+ cell	SRR010959 Ago3 IP in heterozygotes	GSM180331 early embryo (2-6)	S25 1st instar #1	SRR029032 r2d2 knockdown	GSM180330 very early embryo (0-1)	GSM424741 S2 pKF63 transiently transfected	SRR032096 AGO2 IP dcr2 knockdown	SRR001344 dcr-2 beta-eliminated	S15 S2 -48 #1	GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0	SRR001348 ago2 oxidized	S30 s2-48 #2	V025 S2R+ cell	SRR031696_2152	V067 S2-NP	S22 female head #1	SRR023399 RNA bound by P19 protein	SRR010955 Aub IP in Ago3 heterozygotes	SRR031701 Total small RNAs from r2d2 heterozygous flies	SRR029030 dcr-2 knockdown	GSM239052 S2 cells, non beta-eliminated	GSM467730 r2d2	GSM239041 fly heads, non beta-eliminated	GSM424739 S2 parental	SRR029028 untreated (mock)	SRR001346 ago2 beta-eliminated
...........................................TTTTCCCAACTACACCTATTAAT...............................................................................	23	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................TTTCCCAACTACACCTATTAAT...............................................................................	22	1	7	0	0	0	0	0	0	0	3	1	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................TTTCCCAACTACACCTATTAATA..............................................................................	23	1	5	0	0	0	0	0	0	0	1	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
............................................TTTCCCAACTACACCTATTA.................................................................................	20	1	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.............................................TTCCCAACTACACCTATTAATA..............................................................................	22	1	1	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
...................................................................................ATTAAAGTTGTAGTTTGGAAA.........................................	21	1	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
....................................................................................TTAAAGTTGTAGTTTGGAAAGTT......................................	23	1	5	0	1	0	0	1	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
....................................................................................TTAAAGTTGTAGTTTGGAAAGT.......................................	22	1	2100	140	286	99	84	90	74	79	69	89	66	52	82	39	45	58	32	27	24	24	40	25	22	35	26	36	13	22	16	17	16	21	13	16	24	15	13	12	8	10	13	15	7	13	7	6	6	7	5	6	7	0	8	3	8	5	5	4	4	6	0	4	6	6	4	2	3	2	5	4	3	0	2	4	2	0	1	4	1	1	3	1	3	1	2	2	3	3	2	3	2	2	1	1	1	2	2	2	1	2	0	1	1	1	1	1	1	0	1	1	1	1	0	1	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
....................................................................................TTAAAGTTGTAGTTTGGAAA.........................................	20	1	387	98	3	26	54	21	18	7	11	3	17	13	1	14	6	1	6	0	5	6	0	5	5	0	2	0	5	5	1	3	3	1	4	8	0	1	4	3	1	3	1	0	1	0	0	2	0	1	1	2	1	1	0	0	0	0	2	0	0	0	3	1	0	0	1	0	1	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
....................................................................................TTAAAGTTGTAGTTTGGAA..........................................	19	1	111	27	0	2	9	6	5	4	7	4	2	5	1	3	8	1	0	0	0	4	0	4	2	0	0	0	0	0	0	2	0	0	3	1	0	1	0	0	2	1	0	0	1	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
....................................................................................TTAAAGTTGTAGTTTGGA...........................................	18	1	16	3	0	1	1	0	0	0	1	1	1	0	0	1	3	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
....................................................................................TTAAAGTTGTAGTTTGGAAAG........................................	21	1	941	158	28	98	72	45	46	40	34	20	30	39	13	27	5	11	19	16	17	12	5	10	11	7	13	2	17	7	12	7	8	4	6	0	1	6	5	5	7	4	0	0	5	0	5	2	3	0	2	1	0	5	0	5	0	3	0	3	3	0	4	1	0	0	1	3	1	1	0	1	1	2	2	0	2	2	3	0	1	0	0	1	0	2	0	1	0	0	1	0	0	0	1	0	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0	0	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.....................................................................................TAAAGTTGTAGTTTGGAAAG........................................	20	1	4	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
.....................................................................................TAAAGTTGTAGTTTGGAAAGT.......................................	21	1	18	0	0	0	0	2	0	3	0	1	0	1	1	0	1	0	1	1	1	0	0	0	1	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	2	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................AAAGTTGTAGTTTGGAAAG........................................	19	1	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................AAAGTTGTAGTTTGGAAAGT.......................................	20	1	2	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
......................................................................................AAAGTTGTAGTTTGGAAA.........................................	18	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
................................................................................................................TTTGCATTAGAAATCGCCACT............	21	1	1	0	0	0	0	0	0	0	0	0	0	1	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0

Antisense strand

	Size	Blast	Total	V090 CS  male total RNA	V081 embryo 2-6hr	V083 male, one day	V098 dcr-2[L811fsX] ovary	V066 r2d2[1], ovary, AGO1IP	V064 ago2[414], ovary, AGO1IP	SRR014278 Ovary_rep1 w1118(fem)_x_Har(male)_F1	GSM280085 WT testes (18-24nt)	S21 disk #2	V065 dcr-2[L811fsX], ovary, AGO1IP	V088 r2d2[1] ovary total RNA	S5 imaginal disc	V097 CS ovary	V019 GM2 cell	V082 embryo 14-24hr	SRR014276 Ovary_rep1 NA(fem)_x_Har(male)_F1	S24 male body #2	V089 ago2[414] ovary total RNA	SRR014274 Ovary_rep1 LK(fem)_x_Har(male)_F1	SRR031704 2-O-methylated small RNAs from r2d2 homozygous flies	V063 CS,ovary,AGO1IP	SRR014277 Ovary_rep1 NA_P	V084 female, one day	SRR014273 Ovary_rep1_Har_P	SRR031698 2-O-methylated small RNAs from dcr-2 heterozygous flies	SRR014280 Ovary_rep1 w1118_P	GSM379051 Armi Mutant	S9 0-1h #3 (7)	GSM379057 Krimp Mutant	GSM379061 Squ Heterozygote	GSM180335 imaginal discs	SRR014275 Ovary_rep1 LK_P	SRR014281 Ovary_rep1 wK(fem)_x_w1118(male)_F1	S28 0-2d pupae	GSM379063 Vasa Heterozygote	SRR014282 Ovary_rep1 wK_P	SRR031697 Total small RNAs from dcr-2 heterozygous flies	GSM379065 Zuc Heterozygote	GSM379059	S19 2-4day pupae #1	S27 0-1d Pupae (w)	GSM379055 Flam Mutant	SRR014270 Embryo_0-2hrs rep1_NA_0_2hr_Emb	V001 IR-	GSM379067 SpnE Mutant	GSM379054 Flam Heterozygote	V009 CMEL1	GSM379056 Krimp Heterozygote	GSM379064 Vasa Mutant	SRR014279 Ovary_rep1 w1118(fem)_x_wK(male)_F1	SRR029633 total small RNAs from hen1 homozygous flies	SRR032094 ago2 knockdown	SRR014272 Embryo_0-2hrs rep1_wK_0_2hr_Emb	SRR014269 Embryo_0-2hrs rep1_LK_0_2hr_Emb	SRR014271 Embryo_0-2hrs rep1_w1118_0_2hr_Emb	SRR001349 heterozygous dcr-2_untreated	GSM379052 Aub Heterozygote	SRR031702 2-O-methylated small RNAs from r2d2 heterozygous flies	V011 Sg4	GSM343287 Drosophila Toll 10b mutant embryos	GSM379050 Armi Heterozygote	S10 2-6h #1 (8)	S12 6-10h #1 (10)	GSM379066 Zuc Mutant	GSM379058	V002 IR+	GSM280084 loqs-/- ovaries (18-29nt)	V075 ML-DmBG1-C1	GSM379062 Squ Mutant	SRR031692 Total small RNAs from Oregon R	SRR031703 Total small RNAs from r2d2 homozygous flies	S34 KC+48 #1	V026 1182-4H cell	GSM280082 WT ovaries (18-29nt)	GSM379060 SpnE Heterozygote	GSM280083 dcr-2-/- ovaries (18-29nt)	S35 KC+48 #2	SRR031699 Total small RNAs from dcr-2 homozygous flies	S14 0-1hr #1 (A)	S32 s2+48 #2	SRR031693_4	SRR010960 wt, oxidized	GSM379053 Aub Mutant	S3 male body	SRR014268 Embryo_0-2hrs rep1_HAR_0_2hr_Emb	SRR032093 ago1 knockdown	V024 kc167 cell	SRR010951 Ago3 heterozygotes, oxidized	S17 3rd inster #1	SRR001347 ago2 untreated	S7 12-24hr embryo	S13 6-10h #2 (11)	SRR010952 Ago3 trans-heterozygotes, oxidized	V076 ML-DmBG3-C2	S18 3rd inster #2	SRR031700 2-O-methylated small RNAs from dcr-2 homozygous flies	S20 2-4day pupae#2	SRR001664 homozygous dcr-2_untreated	SRR010958 Piwi IP in Ago3 trans-heterozygotes	V033 CMEW1 Cl.8+ cell	V008 S2-DRSC	V018 Kc167 cell	OSS8 Drosophila OSS cell small RNA libraries, rep4	SRR001341 WT_males non-beta-eliminated	SRR029031 loqs-ORF knockdown	GSM180336 pupae: 0-1 day, 0-2 day, 2-4 day	V010 MLDmD20c5	SRR010954 Aub trans-heterozygotes, oxidized	OSS2 Drosophila OSS cell small RNA libraries, rep1	SRR001343 dcr-2 non-beta-eliminated	GSM280088 S2cell (AGO1IP)	S8 S2-48,+48, KC-48, +48 mix	OSS7 Drosophila OSS cell small RNA libraries, rep3	V021 ML-DmD21 cell	SRR001339 WT_females non-beta-eliminated	SRR001338 IR non-beta-eliminated	OSS6 Drosophila OSS cell small RNA libraries, rep2	S2 female head	GSM180329 adult bodies (female bodies, male bodies)	SRR010953 Aub heterozygotes, oxidized	GSM280087 S2cell (AGO2IP)	GSM280086 WT ovaries (AGO2IP)	S29 male head #1	S26 1st instar #2	S11 2-6h #2 (9)	GSM180333 late embryo (12-24)	GSM239051 S2 cells, beta-eliminated	GSM180332 mid embryo (6-10)	S16 KC -48 #1	GSM180328 adult heads (female heads, male heads)	S4 female body	GSM154621 piRNAs associated with Ago3 from Drosophila melanogaster ovaries	S31 s2+48 #1	SRR010957 Aub IP in Ago3 trans-heterozygotes	SRR001337 WT_females beta-eliminated	SRR023197 RNA Library from S2 control cells	SRR032092 mock oxidized	S23 female body #2	SRR029033 lacZ knockdown	SRR010956 Piwi IP in Ago3 heterozygotes	GSM424740 S2 pKF63 stably transfected	SRR023400 total RNA extracted from P19 cells	SRR001345 ago2 non-beta-eliminated	V020 S2R+ cell	SRR023407 RNA bound by NLS-P19 protein	GSM180337 tissue culture cells (S2 only)	SRR023402 total RNA extracted from NLS-P19 cells	SRR001340 IR beta-eliminated	GSM467731 loq	GSM154622 piRNAs associated with Aubergine from Drosophila melanogaster ovaries	S1 male head	GSM467729 WT	GSM154620 piRNAs associated with Piwi from Drosophila melanogaster ovaries	SRR001342 WT_males beta-eliminated	GSM154618 23-29 nucleotide RNAs from Drosophila melanogaster ovaries	S33 KC-48 #2	GSM231091 PIWI-associated piRNA in Drosophila melanogaster ovary (454 Pyrosequencing, 2006)	GSM246084 D. melanogaster adult male heads 454	GSM239050 fly heads, beta-eliminated	SRR032095 AGO1 IP dcr2 knockdown	SRR029029 dcr-1 knockdown	GSM180334 larvae: 1st instar and 3rd instars	V028 CMEW1 Cl.8+ cell	SRR010959 Ago3 IP in heterozygotes	GSM180331 early embryo (2-6)	S25 1st instar #1	SRR029032 r2d2 knockdown	GSM180330 very early embryo (0-1)	GSM424741 S2 pKF63 transiently transfected	SRR032096 AGO2 IP dcr2 knockdown	SRR001344 dcr-2 beta-eliminated	S15 S2 -48 #1	GSM266765 Siomi Lab fruit fly S2 AGO2 Cloned Sequences v1.0	SRR001348 ago2 oxidized	S30 s2-48 #2	V025 S2R+ cell	SRR031696_2152	V067 S2-NP	S22 female head #1	SRR023399 RNA bound by P19 protein	SRR010955 Aub IP in Ago3 heterozygotes	SRR031701 Total small RNAs from r2d2 heterozygous flies	SRR029030 dcr-2 knockdown	GSM239052 S2 cells, non beta-eliminated	GSM467730 r2d2	GSM239041 fly heads, non beta-eliminated	GSM424739 S2 parental	SRR029028 untreated (mock)	SRR001346 ago2 beta-eliminated