| seed | ---------------------------------------------------------------------------CACAACC---------------------------------------------- | 80 | miR-67 |
| seed | --------------------------------------------------------------------------UCACAAC----------------------------------------------- | 1 | novel |
| seed | --------------------------------------------------------------------------------CCUCCUA----------------------------------------- | 1 | novel |
| | | | CE1 |
| | --------------------------------------------------------------------------TCACAACCTCCTAGAAAGAGTAG------------------------------- | 23 | 45 |
| | --------------------------------------------------------------------------TCACAACCTCCTAGAAAGAGT--------------------------------- | 21 | 30 |
| | --------------------------------------------------------------------------TCACAACCTCCTAGAAAGAG---------------------------------- | 20 | 2 |
| cel-miR-67 | --------------------------------------------------------------------------TCACAACCTCCTAGAAAGAGTAGA------------------------------ | 24 | 2 |
| | -------------------------------------------------------------------------ATCACAACCTCCTAGAAAGAGT--------------------------------- | 22 | 1 |
| | --------------------------------------------------------------------------TCACAACCTCCTAGAAAG------------------------------------ | 18 | 1 |
| | -------------------------------------------------------------------------------ACCTCCTAGAAAGAGTAG------------------------------- | 18 | 1 |
| celegans | ---------GATCAAAGAT--TCGTCGATCCGCTCATTCTGCCGGTTGTTATGCTATTATCAGA---TTAAGCATCACAACCTCCTAGAAAGAGTAGATCGATTTTAAAACTT--------------- | |
| cbriggsae | ------TAAAATTCTAGAT--ATTTCGATCAACTCATTCTGCTGGTTGTTATGCTGACAATTGATGATTAAGCATCACAACCTCCTAGAAAGAGTAGACCGATTCTATCTTATCTTTTTA-------- | |
| cjaponica | GAATACGTCGGTCCGAGATAACCGTCGATCCGCTCGTTCTGATGGTTGTTATGCCGATCCGAGA-GAAGAAGCATCACAACCTCCAAGAAAGAGTAGATCGACACCGTATCTCAATTCAAGGTTCTTC | |
| cbrenneri | ------------------------------AACTCATTCTGCTGGTTGTTATGCCAAACATTGAAATTTAAGCATCACAACCTCCTAGAAAGAGTG-------------------------------- | |
| ppacificus | ---TACCGTAGTCCACGGT--TCACC--TCAACGCCCTCTGTGGGTTGTCTGACTCACAGTGAG---ATCAGTCACACAACCTCCTAGAGTGTGTCGA--GGTTCGTGATCTACCGTA---------- | |
| cremanei | ---------------AGAT--TATTCGATCAACTCGTTCTGCTGGTTGTTATGCTGAAACAGAA---AGAAGCATCACAACCTCCTAGAAAGAGTAGATCGATTCAATCT------------------ | |
| | * * **** ****** * ** ********** *** * ** | |
| | +++++ ++++++++++ +++++++++++++++++++++++++++++++++++++++++++ ++++++++++++++++++++++++++++++++++++++++++++++ +++++ | EGAP1.3 EGAP1.3 zmp-1 |
| celegans | .......... ..(((((((..(((.(((((..((((((.(((((......... ...))))).))))))...))))).)))..))))))).......... | 1.000 -32.20 |
| cbriggsae | (((((....(((( (..(((.((.((((.(((((..((((((.(((((...............))))).))))))...))))).)))).)).)))...))))).....))))) | 0.999 -31.36 |
| cjaponica | ((((.....((...((((((...(((((((..(((.((((...((((((.((((...((..... ...)).)))).))))))....)))).)))..)))))))....))))))...))...))))... | 0.899 -41.50 |
| cbrenneri | .((((.(((((..((((((.((((.................)))).))))))...))))).)))). | 1.000 -19.73 |
| ppacificus | (((.((((..(((((. ..((( ((.((((.(((((.((((((((((((((.....))) .))))....)))))))..))))).)))).)) ))))))))..)))).))) | 1.000 -44.80 |
| cremanei | (((( (..((((((.((((.(((((..((((((.(((((......... ...))))).))))))...))))).)))).))))))...))))) | 1.000 -34.70 |
| celegans | chromosome:III:5931300:5931398:-1 | Same_strand|Intronic_coding|EGAP1.3|EGAP1.3 ## EGAP1.3|protein_coding|zmp-1|zmp-1 encodes a zinc matrix metalloproteinase that enables anchor cell (AC) invasion during postembryonic vulval development. ZMP-1's proteinase activity has been confirmed in vitro. N-terminus to C-terminus, ZMP-1 is predicted to have a signal sequence, peptidoglycan-binding domain, a central matrix protease domain, a coiled-coil domain, and four hemopexin domains. ZMP-1 is expressed in AC during larval development, vulD and vulE in larvae and adults, and vulA in young adults onward. ZMP-1 is expressed in AC at the time it invades the basement membrane (L3 larval stage), and is localized to puncta often concentrated at the invasive basolateral membrane. ZMP-1::GFP diffuses from AC to utse cytoplasm upon fusion of these cells. ZMP-1 expression in AC requires EGL-43 (perhaps directly), and FOS-1A (indirectly). transcription of zmp-1 in AC, vulA, and vulE is driven by physically distinct sites in the zmp-1 5' flanking sequence. other regulators of ZMP-1 expression in other cell types include COG-1, EGL-38, LIN-11, LIN-29, and NHR-67. zmp-1(cg115) and zmp-1(RNAi) animals have no grossly obvious phenotypes, but null zmp-1(cg115) mutations enhance a subtle defect of AC invasion seen with null cdh-3(pk87) or him-4(rh319) mutations. [Source: WormBase] ## {SimpF: WRM0639dE02 -1 fosmid,WRM0633cF08 -1 fosmid,WRM067aB08 -1 fosmid,WRM0624bE02 -1 fosmid,WRM064bH05 -1 fosmid,WRM062aE09 -1 fosmid} ## {MIR: cel-mir-67} |
| cbriggsae | chromosome:chrIII:2802674:2802785:1 | Same_strand|Intronic_coding|NM_001011629 ## Opposite_strand|Intronic_coding|NM_007496 ## {MIR: cbr-mir-67} |
| cjaponica | chromosome:chrUn:137728626:137728752:1 | Same_strand|Intronic_coding|NM_171138 |
| cbrenneri | chromosome:chrUn:27481488:27481626:-1 | Opposite_strand|Intronic_coding|NM_171138 |
| ppacificus | chromosome:chrUn:118105751:118105856:1 | Opposite_strand|Intronic_coding|NM_080760 |
| cremanei | chromosome:chrUn:20982884:20982973:1 | Same_strand|Intronic_coding|NM_001051693 |