cel-mir-87
| absolute | CE1 |
| cel-mir-87 5arm | 1 |
| cel-mir-87 3arm | 171 |
| normalized | CE1 |
| cel-mir-87 5arm | 0.001 |
| cel-mir-87 3arm | 0.119 |

sblock57 (miRBase cel-mir-87) [miRNAknown_cloningHIGH_multiarm_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-87 | 0.001 | no | no | 0.45/0.55 | 18/22/0.98 | 0.0 0.0 | 0.0 0.0 | 1 145 | 0 0 | 1 1 | 0 0 | 40 12 | -15 9 | 5arm_loop_3arm 3arm | 1 1 | nd nd | 0.40 0.09 | 6 1 | 172 | 1 | na | na |
| Member of family miR-233/356/87 (seed UGAGCAA): cel-mir-233, cel-mir-87 |

| reads | miRBase family seed | ||
| seed | -----------------------------------------------------------------------------------UGAGCAA------------------------------------------ | 166 | miR-233/356/87 |
| seed | ------------------------------------------------------------------------------------GAGCAAA----------------------------------------- | 3 | novel |
| seed | ---------------------------------------------------------------------------------------CAAAGUU-------------------------------------- | 2 | novel |
| seed | -------------------------------------------------------------GCUG--UCA-------------------------------------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| cel-miR-87 | ----------------------------------------------------------------------------------GTGAGCAAAGTTTCAGGTGTGC---------------------------- | 22 | 145 |
| ----------------------------------------------------------------------------------GTGAGCAAAGTTTCAGGTGTG----------------------------- | 21 | 18 | |
| -----------------------------------------------------------------------------------TGAGCAAAGTTTCAGGTGTGC---------------------------- | 21 | 3 | |
| ----------------------------------------------------------------------------------GTGAGCAAAGTTTCAGGTGT------------------------------ | 20 | 2 | |
| --------------------------------------------------------------------------------------GCAAAGTTTCAGGTGTGC---------------------------- | 18 | 2 | |
| ----------------------------------------------------------------------------------GTGAGCAAAGTTTCAGGTG------------------------------- | 19 | 1 | |
| ------------------------------------------------------------CGCTG--TCAGATTGGTCGTAG-------------------------------------------------- | 20 | 1 | |
| celegans | -------------------GGTTGTG-CCATCCGGCCGCCTGATACTTTCGTCTCAACCTCGCTG--TCAGATTGGTCGTAGGTGAGCAAAGTTTCAGGTGTGCCGGAACACACCC---------------- | ||
| cbriggsae | -------------------GGTTGTGCCCACCCGGCCGCCTGATACTTTCGTCTCAACCTCGCTG--TCAGA-ATGTCGTAGGTGAGCAAAGTTTCAGGTGTGCCGGAACACACCC---------------- | ||
| cjaponica | ----------------------------------GCCGCCTGACACTTTCGTCTCAACCTCGCT---TCAGA-TGGCCGTAGGTGAGCAAAGTTTCAGGTGTGC---------------------------- | ||
| cbrenneri | -----------------------GTG-CCTTCCGGCCGCCTGATACTTTCGTCTCAACCTCGCTTC-TCTCA-TTGTCGTAGGTGAGCAAAGTTTCAGGTGTGCCGGAACACAC------------------ | ||
| ppacificus | -----------------GGGGTGACGTCATGCTCGTCGCCTGA-ACTTGTA-CTCAACCTCGTCA--ATAGA-TGAGCGCAGGTGAGCAAAGTTTCAGGTGTGCGAGCTAGCGTCCCCC------------- | ||
| cremanei | AAACTTCTTCATCCATACAGGTTGTG-CCTTCCGGCCGCCTGACACTTTCGTCTCAACCTCGCTGTCTGATA-TAGTCGTAGGTGAGCAAAGTTTCAGGTGTGCCGGAACACATCCTCACTTTGCCCAGTTT | ||
| * ******* **** ********** * ** ************************ | |||
| +++++ +++++++ ++++++++++++++++++++++++++++++++++++++ +++++++++++++++++++++++++++++++++++++++++++++++++ +++++ | F10C2.2 F10C2.2 kup-1 | ||
| celegans | (((.((( ...(((((((((((((.(((((.(.((((.(((((((( ......))).)).))))))))))))).))))))).)))))).)))))). | 1.000 -44.60 | |
| cbriggsae | ((.((((.....((((((((((((.(((((...(((.((((((.(( (.... ))).)).))))))).))))).))))))).)))))..)))))). | 0.994 -38.10 | |
| cjaponica | (((((((((.(((((...(((.(((((((( ..... .)).)).))))))).))))).))))))).)) | 1.000 -26.20 | |
| cbrenneri | ((( ..((((((((((((((.(((((...(((.((((((.... ..... ....)).))))))).))))).))))))).)))))))))).. | 0.999 -38.02 | |
| ppacificus | ((((.(((((...((((((((((((( ((((... (((.((((((((( ..... ))).)).)))))))..))))).)))))).))))))..))))))))) | 1.000 -50.30 | |
| cremanei | ..................(((.(((( ..((((((((((((((.(((((...(((.((((((((((.....) ))).)).))))))).))))).))))))).))))))))))).)))............... | 0.918 -47.30 |
| celegans | chromosome:V:12038665:12038758:-1 | Same_strand|Intronic_coding|F10C2.2|F10C2.2 ## F10C2.2|protein_coding|kup-1|kup-1 encodes a novel protein that is conserved in C. briggsae, but contains no other known homologs. kup-1 is the upstream gene in an operon with pkc-1, which encodes two protein kinase C isoforms of the nPKC isotype. the polycistronic kup-1/pkc-1 mRNA is detected at low levels in embryos and larvae, but its expression greatly increases in adults. as loss of kup-1 activity via large-scale RNAi screens does not result in any obvious abnormalities, the precise role of kup-1 in C. elegans development and/or behavior is not yet known. [Source: WormBase] ## {SimpF: CEOP5312 1 Operon,WRM0626bF07 -1 fosmid,WRM063aG10 -1 fosmid,WRM0621bH11 -1 fosmid,WRM0622bH03 -1 fosmid} ## {MIR: cel-mir-87} |
| cbriggsae | chromosome:chrV:6389696:6389789:1 | Same_strand|Intronic_coding|NM_031366 ## Opposite_strand|Intronic_coding|NM_001087279 ## {MIR: cbr-mir-87} |
| cjaponica | chromosome:chrUn:17231967:17232100:1 | intergenic |
| cbrenneri | chromosome:chrUn:83992867:83992954:1 | Same_strand|Intronic_coding|NM_073615 |
| ppacificus | chromosome:chrUn:113454284:113454380:-1 | Same_strand|Intronic_coding|NM_001014737 |
| cremanei | chromosome:chrUn:126942557:126942686:-1 | Same_strand|Intronic_coding|NM_073615 |
