cel-mir-1833
block4872 (miRBase cel-mir-1833) [miRNAknown_rep_shortStem_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-1833 | 0.001 | no | DNA,UNKNOWN | 0.52/0.52 | 23/23/1.00 | nd | nd | 0 | 0 | 0 | 0 | 0 | 13 | 3arm | 1 | nd | 0.14 | 2 | 0 | 0 | na | na |
| reads | miRBase family seed | |
| seed | ---------------------------------------------------------------------------------GAGGCUU--------------- | 0 | novel |
| len | cloning frequencies | |
| cel-miR-1833 | --------------------------------------------------------------------------------CGAGGCTTGCGAAATAAGTGTGC | 23 |
| celegans | ACGCTTACTTCGCAA--------------GCCTCGCGCGTTTTCTTTT----------CAAGA------GAAAAAGCGTGCGAGGCTTGCGAAATAAGTGTGC | |
| cbriggsae | GGCCAGATCTCCCACAAGTCTAGCACAAGTCTCCGAGCACATTATTCTATGTATTAGCTAAGACTTGTGGGAGGCTTGTGCAAGACTTGTGGAAGACTTGTCC | |
| ppacificus | -----GCCTTTCTAC--------------TTTCCGAGC-CCTCATTCGCCAT------CAAAC----TGGGAACGGTGTGTGAGGCTTAAAAAATA-GAATGC | |
| * * ** ** * ** ** * * *** ** *** ** * * * | ||
| ++++++++++++++++++++ +++++++++++++++++++ +++++ +++++++++++++++++++++++++++++++++++++++ | Y41E3.4 Y41E3.4 ers-1 | |
| celegans | (((((((.((((((( (((((((((((((((((.. ...)) ))))..)))))))))))))))))).))))))).. | 1.000 -47.70 |
| cbriggsae | (((.((.(((.((((((((((.((((((((((((...((((....(((..((....))..)))..)))))))))))))))).)))))))))).))))).))). | 0.984 -49.70 |
| ppacificus | ((..(((((. (((..(((. ((((((.((((.( (.... ...))..)))).)))))))))..))).)) ))).)) | 1.000 -21.10 |
| celegans | chromosome:IV:15012308:15012380:-1 | Same_strand|Intronic_coding|Y41E3.4|Y41E3.4 ## Y41E3.4|protein_coding|ers-1|ers-1 encodes a glutaminyl (Q) tRNA synthetase that affects growth and embryonic and larval viability in large-scale RNAi screens. it is predicted to be mitochondrial. [Source: WormBase] ## {Repeats: trf 13 36 0 class=trf,Ce000253 114 137 1 class=UNKNOWN} ## {SimpF: Y41E3.4 -1 Expression_profile,oe = 1.03 0 CpG} ## {MIR: cel-mir-1833} |
| cbriggsae | chromosome:chrV:15256935:15257037:1 | Same_strand|Intronic_coding|NM_065290 ## {Repeats: DNA2-10_CB 1 1355 1 class=DNA} ## {SimpF: trf,trf} |
| ppacificus | chromosome:chrUn:74025648:74025719:1 | intergenic |
©2008 InteRNA Genomics B.V.