other miRBase miRNAs
miRNAknown_lenNOK_cloningHIGH_multiarm_DicerNOK_randfoldOK (2 loci)
cel-mir-42
| absolute | CE1 |
| cel-mir-42 5arm | 3 |
| cel-mir-42 3arm | 126 |
| normalized | CE1 |
| cel-mir-42 5arm | 0.002 |
| cel-mir-42 3arm | 0.088 |
sblock23 (miRBase cel-mir-42) [miRNAknown_lenNOK_cloningHIGH_multiarm_DicerNOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-42 | 0.001 | no | no | 0.39/0.50 | 18/23/0.45 | 0.0 0.0 | 1.7 0.9 | 3 121 | 0 0 | 1 1 | 0 0 | 12 15 | 7 9 | 5arm 3arm | 1 1 | nd nd | 0.22 0.05 | 4 1 | 129 | 1 | -1 | 1 |
| Located in cluster 2: cel-mir-42, cel-mir-43, cel-mir-44 |
| reads | miRBase family seed | ||
| seed | ---------------------------------------------------------------------------------CACCGGG-------------------------------------- | 123 | miR-35/36/38/39/40/41 |
| seed | ----------------------------GUGGGUG------------------------------------------------------------------------------------------- | 3 | novel |
| seed | ----------------------------------------------------------------------------------ACCGGGU------------------------------------- | 2 | miR-42 |
| seed | -------------------------------------------------------------------------------------GGGUUAA---------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| --------------------------------------------------------------------------------TCACCGGGTTAACATCTAC--------------------------- | 19 | 67 | |
| --------------------------------------------------------------------------------TCACCGGGTTAACATCTACAG------------------------- | 21 | 54 | |
| --------------------------------------------------------------------------------TCACCGGGTTAACATCTACAGAG----------------------- | 23 | 2 | |
| ---------------------------TGTGGGTGTTTGCTTTTT--------------------------------------------------------------------------------- | 18 | 2 | |
| ------------------------------------------------------------------------------------CGGGTTAACATCTACAGA------------------------ | 18 | 1 | |
| ---------------------------------------------------------------------------------CACCGGGTTAACATCTACAGA------------------------ | 21 | 1 | |
| ---------------------------------------------------------------------------------CACCGGGTTAACATCTAC--------------------------- | 18 | 1 | |
| ---------------------------TGTGGGTGTTTGCTTTTTCGG--TG-------------------------------------------------------------------------- | 23 | 1 | |
| cel-miR-42 | --------------------------------------------------------------------------------TCACCGGGTTAACATCTACAGA------------------------ | 22 | - |
| celegans | ---------------TTCGCGGACCTTTGTGGGTGTTTGCTTTTTCGG--TGAAGTT----GTCTTCCGTAGCTTCTTCTTCACCGGGTTAACATCTACAGAGGTCCAAAAAGGGG---------- | ||
| cbriggsae | ----------AACCCTTGTCGGACCTTTGTGGGTGTTCGCCTTTTCGG--TGAAGT----------TACTGAATGCTTCTTCACCGGGTTAACATCTACAGAGGTCCTAAAGGGTT---------- | ||
| cjaponica | TCTCGTCTTGAGACGCCGTTGGACCTCCGTGGATGTTTGCTTTTGCGG--TGAAGAG--------GTGATAACGGGCGCTTCACCGGGTTAACATCTACAGAGGTCCGGGCGTCTTCGTGGCGGGA | ||
| cbrenneri | --------------------------TTGTGGATGTTTGCCTTTTCGG--TGAAGTT---------TCAAAAGATATTCTTCACCGGGTTAACATCTACAG------------------------- | ||
| ppacificus | ---CATAGTGCATTCAGTGCAGCCCGCAGTGGGTGTCTGCCT---CGGTCTGAAGTGTGAGATGCATGATCCTCCGTTCTTCACCGGGTGAACATCCATTGCGGGCGCATGCACCCTG-------- | ||
| cremanei | ---------AAACCCTTGTCGGACCTTTGTGGATGTTTCCTTTTTCGG--TGAAGTT---GTTCCGTTGAATTATCTTCTTCACCGGGTTAACATCTACAGAGGTCCTCGAGGGTTT--------- | ||
| **** *** * * *** ***** *********** ****** * * | |||
| celegans | .....(((((((((((((((((.(((....((( (((((.. ((........)).....))))))))))).)))))))))))))))))......... | 1.000 -41.70 | |
| cbriggsae | (((((((...(((((((((((((((((.(((....((( (((((. ............))))))))))).)))))))))))))))))..))))))) | 1.000 -51.62 | |
| cjaponica | (((((((..((((((((..((((((((.(((((((((.(((....((( (((((.. ((........)).))))))))))).))))))))).))))))))))))))))...))))))) | 1.000 -64.70 | |
| cbrenneri | .((((((((((.(((....((( (((((.. ((....))....))))))))))).)))))))))). | 1.000 -28.50 | |
| ppacificus | ....(((((.....(((.(((((((((((((((..(((. ((((..((((...(((..........)))....)))))))))))..))))))))))))))))))))))).... | 0.999 -54.40 | |
| cremanei | (((((((((..(((((((((((((((((..((....((( (((((.. ((((....))))......))))))))))..))))))))))))))))).))))))))) | 1.000 -54.20 |
| celegans | chromosome:II:11889727:11889821:1 | intergenic ## {SimpF: WRM0618bC04 1 fosmid,WRM0615cF06 1 fosmid,WRM061cG08 1 fosmid,WRM0623bB10 1 fosmid,WRM064dE11 1 fosmid} ## {MIR: cel-mir-42} |
| cbriggsae | chromosome:chrII:8049572:8049665:-1 | Same_strand|Intronic_coding|NM_001047975 ## Opposite_strand|Intronic_coding|NM_133464 ## {MIR: cbr-mir-42} |
| cjaponica | chromosome:chrUn:98919245:98919360:-1 | intergenic |
| cbrenneri | chromosome:chrUn:101676437:101676571:1 | Opposite_strand|Intronic_coding|NM_007742 ## Same_strand|Intronic_coding|NM_138591 |
| ppacificus | chromosome:chrUn:21366661:21366772:-1 | Opposite_strand|Intronic_coding|NM_001032504 ## Same_strand|Intronic_coding|NM_066966 ## {Repeats: G-rich 6 78 -1 class=Low_complexity} |
| cremanei | chromosome:chrUn:8362075:8362177:1 | intergenic |
cel-mir-239a
| absolute | CE1 |
| cel-mir-239a 5arm | 28 |
| cel-mir-239a 3arm | 54 |
| normalized | CE1 |
| cel-mir-239a 5arm | 0.020 |
| cel-mir-239a 3arm | 0.038 |
sblock78 (miRBase cel-mir-239a) [miRNAknown_lenNOK_cloningHIGH_multiarm_DicerNOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-239a | 0.001 | no | no | 0.33/0.50 | 18/24/0.49 | 0.0 0.0 | 0.0 0.0 | 26 39 | 0 0 | 1 1 | 0 0 | 15 23 | 1 2 | 5arm 3arm | 1 1 | nd nd | 0.17 0.17 | 2 2 | 82 | 1 | 1 | -3 |
| Member of family miR-239a (seed UUGUACU): cel-mir-238, cel-mir-239a |
| reads | miRBase family seed | ||
| seed | ---------------------------------------------------------------------AGUGUCU---------------------------------- | 43 | novel |
| seed | ------------------------UUGUACU------------------------------------------------------------------------------- | 27 | miR-239a |
| seed | ----------------------------------------------------------------------GUGUCUA--------------------------------- | 11 | novel |
| seed | -----------------------UUUGUAC-------------------------------------------------------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| --------------------------------------------------------------------CAGTGTCTAGTCTAGTGC------------------------ | 18 | 39 | |
| cel-miR-239a | -----------------------TTTGTACTACACATAGGTACTG--G-------------------------------------------------------------- | 23 | 26 |
| ---------------------------------------------------------------------AGTGTCTAGTCTAGTGCAAAC-------------------- | 21 | 9 | |
| --------------------------------------------------------------------CAGTGTCTAGTCTAGTGCAAAC-------------------- | 22 | 3 | |
| --------------------------------------------------------------------CAGTGTCTAGTCTAGTGCA----------------------- | 19 | 1 | |
| ---------------------------------------------------------------------AGTGTCTAGTCTAGTGCA----------------------- | 18 | 1 | |
| -----------------------TTTGTACTACACATAGGT--------------------------------------------------------------------- | 18 | 1 | |
| ---------------------------------------------------------------------AGTGTCTAGTCTAGTGCAAACA------------------- | 22 | 1 | |
| ----------------------TTTTGTACTACACATAGGTACTG--G-------------------------------------------------------------- | 24 | 1 | |
| celegans | ----TACACGTT----TGCAATTTTTGTACTACACATAGGTACTG--GACAATTT-TCAAAATATATCCAGTGTCTAGTCTAGTGCAAACATTGCTCGGTGTTGTTTGA- | ||
| cbriggsae | --GATCCAAGTTTA--TGCGATTTTTGTACTACAATTAGGTACTG--GACACCAGCAGCGAGTGTATCCAGAATCTATACTAGTACAAAAATAGCTAACAGGATT----- | ||
| cjaponica | -----------------------TTTGTACTACACATAGGTACTGGTGAAAACGT------GTTTAACCAGTGCCTGGTCTAGTGCAAG--------------------- | ||
| cbrenneri | TTGATATAACCTGAAATGCGGTTTTTGTACTACACATAGGTACTG--GAAAACTTACCACAGATTATCCAGTGCTTGGTCTAGTGCAAGAATTGCTAAGGGGGTTTTCAA | ||
| cremanei | --AATCCAAGAT----TGCGATTTTTGTACTACACATAGGTACTG--GACACTGA---GATTTGTATCCAGAATCTATTCTAGTGCAAAAATTGCTCTGGATT------- | ||
| *********** ********* ** * ** **** * ***** *** | |||
| celegans | .((((... .(((((.(((((((((.((.(((..(((( ((...... ..........))))))..))))).))))))))).)))))...))))....... | 1.000 -32.69 | |
| cbriggsae | (((((..(((.. .((.((((((((((((....(((((.((( ((.((..((.....)))).))))).)))))...)))))))))))).)).))).))))) | 0.998 -31.80 | |
| cjaponica | .((((((((.((.(((((((((((..(((... .))).))))))))))))).)))))))). | 1.000 -28.40 | |
| cbrenneri | .(((...(((((.....(((((((((((((((.((.((((((((( ((.((((......)).)).))))))))))))).))))))))))))))).....))))).))). | 1.000 -42.40 | |
| cremanei | (((((.(((. .(((((((((((((((...((((((.((( ((.((... .....)).))))).))))))..))))))))))))))))))))))) | 1.000 -38.10 |
| celegans | chromosome:X:11792369:11792466:1 | intergenic ## {SimpF: WRM0624bH08 1 fosmid,WRM067bC07 1 fosmid,WRM064aB01 1 fosmid,WRM0632aD05 1 fosmid,WRM068cE04 1 fosmid,WRM0621bA09 1 fosmid,WRM0628bH10 1 fosmid,WRM0624aG10 1 fosmid,WRM0610bH05 1 fosmid} ## {MIR: cel-mir-239a} |
| cbriggsae | chromosome:chrX:15175315:15175413:1 | Same_strand|Intronic_coding|NM_001099298 ## Opposite_strand|Intronic_coding|NM_077585 ## {MIR: cbr-mir-239a} |
| cjaponica | chromosome:chrUn:61791059:61791196:-1 | intergenic |
| cbrenneri | chromosome:chrUn:34416635:34416742:-1 | intergenic |
| cremanei | chromosome:chrUn:26917103:26917194:-1 | intergenic |
miRNAknown_multiarm_DicerNOK_shortStem_randfoldOK (2 loci)
cel-mir-1830
| absolute | CE1 |
| cel-mir-1830 3arm | 1 |
| normalized | CE1 |
| cel-mir-1830 3arm | 0.001 |
sblock11 (miRBase cel-mir-1830) [miRNAknown_multiarm_DicerNOK_shortStem_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-1830 | 0.001 | no | no | 0.48/0.50 | 22/23/1.00 | nd 0.0 | nd 0.0 | 0 1 | 0 0 | 0 1 | 0 0 | 0 0 | 8 12 | 5arm 3arm | 1 1 | nd nd | 0.09 0.18 | 1 2 | 1 | 1 | 1 | 0 |
| reads | miRBase family seed | ||
| seed | ------------------------------------------------------------------------CUAGGAA------------------------------- | 1 | novel |
| seed | -----------------GAGGUUU-------------------------------------------------------------------------------------- | 0 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| -----------------------------------------------------------------------CCTAGGAAATGA-GAAAACTCGGC--------------- | 23 | 1 | |
| cel-miR-1830 | ----------------CGAGGTTTC----ACGTTTTCTAGGC-------------------------------------------------------------------- | 22 | - |
| celegans | ----------------CGAGGTTTC----ACGTTTTCTAGGC---CACGCCGCAAATAG-CCAGCTTGTGGCCTAGGAAATGA-GAAAACTCGGC--------------- | ||
| cbriggsae | ---------------CCTAACTTTTTGAAGAGTTTTCTAGGCCATCGTTCTGAAACTTA-CAACTAGGTGGCCTAGGAAATTG-GAAAACTCGG---------------- | ||
| cjaponica | ----------------CGAGGTTTC----ACGTTTT---------GATGTCGCAACTCGATTGATATACTCGGTATAAAACGCTGAAAACTCG----------------- | ||
| ppacificus | AAAAAAAACCCGCTTTCGAGGTTTC-----CGTTAACAAGGCACGTAATTTACCATTCG-TAAACACACCCGTT---AATCATAGAAGCCTCGATTTCGAAGTTCTTTTT | ||
| * * *** *** * * * ** *** **** | |||
| +++++ +++++++++ +++++++++++++ ++++++++++++++ +++++++++++++++++++++++ +++++++++++ +++++ | B0286.3 B0286.3 B0286.3 | ||
| celegans | ((((.(((( .(((((((((((( (((((.((.....) )..))..))))))))))))))). )))).)))).. | 1.000 -35.80 | |
| cbriggsae | ...............((((((((((((((((....((....... ))....)))))))))))))))). .......... | 0.765 -23.10 | |
| cjaponica | ((((.(((( ((((((( .((..((....((....))......))..)))))))).))))).)))) | 0.510 -14.70 | |
| ppacificus | (((((.(((.((...(((((((((( .((((((..((...((..(((((.....) )))).)).)).))) )))....))))))))))...))..))).))))) | 0.948 -21.60 |
| celegans | chromosome:II:4371833:4371902:-1 | Same_strand|Intronic_coding|B0286.3|B0286.3 ## B0286.3|protein_coding|B0286.3|Probable multifunctional protein ADE2 [Includes: Phosphoribosylaminoimidazole-succinocarboxamide synthase (EC 6.3.2.6) (SAICAR synthetase); Phosphoribosylaminoimidazole carboxylase (EC 4.1.1.21) (AIR carboxylase) (AIRC)]. [Source:UniProtKB/Swiss-Prot;Acc:Q10457] ## {SimpF: WRM0634bG09 -1 fosmid,WRM0638aG07 -1 fosmid} ## {MIR: cel-mir-1830} |
| cbriggsae | chromosome:chrIV_random:205159:205268:1 | Opposite_strand|Intronic_coding|NM_069099 |
| cjaponica | chromosome:chrUn:73591632:73591741:-1 | Opposite_strand|Intronic_coding|NM_059500 |
| ppacificus | chromosome:chrUn:147360305:147360405:-1 | intergenic |
cel-mir-1829b
| absolute | CE1 |
| cel-mir-1829b 3arm | 0.333 |
| normalized | CE1 |
| cel-mir-1829b 3arm | 0.000 |
sblock81 (miRBase cel-mir-1829b) [miRNAknown_multiarm_DicerNOK_shortStem_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-1829b | 0.001 | no | no | 0.36/0.39 | 22/23/1.00 | nd 0.0 | nd 0.0 | 0 1 | 0 0 | 0 1 | 0 0 | 0 0 | 4 6 | 5arm 3arm | 1 3 | nd nd | 0.17 0.29 | 2 3 | 1 | 1 | 2 | 0 |
| Member of family novel1 (seed AACCACU): cel-mir-1829c, cel-mir-1829b |
| reads | miRBase family seed | ||
| seed | -----------------------------------------------------AACCACU-------------- | 1 | novel |
| seed | -AGCGAUC------------------------------------------------------------------ | 0 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| ----------------------------------------------------CAACCACTGGAATTTCTCTATT | 22 | 1 | |
| cel-miR-1829b | AAGCGATC-----TTCTAGATGGTTGTA---------------------------------------------- | 23 | - |
| celegans | AAGCGATC-----TTCTAGATGGTTGTA---AAACATCGA-GTAT-----TACAACCACTGGAATTTCTCTATT | ||
| cremanei | TAGCTGTT-----TTCTGAGAGGGAATG---AAAAAACGATGCAT-----TTCAACCACTTTCATTTTCAGTTC | ||
| cbriggsae | AAGCGATCACAGATCTTGAAAGTCAATACCCAACCATCAA-GGATGAGTATCCAAGCTCTGACATCGTCGCCA- | ||
| *** * * * * * ** * * * * ** * *** * ** ** | |||
| +++++++++++++ +++++++++++++++ +++++++++ ++++ +++++++++++++++++++++++++++++ | F20D1.3 F20D1.3 F20D1.3 | ||
| celegans | .((.((.. ((((((.(((((((( (.((..... )).) ))))))))))))))..)).))... | 1.000 -21.90 | |
| cremanei | .(((((.. ...((((((((..(( (((..........) )))).)).))))))....))))). | 0.999 -12.40 | |
| cbriggsae | ..(((((..((((.((((.......((((.((.((..... )).)).)))).)))).)))).....))))).. | 0.873 -15.30 |
| celegans | chromosome:X:14977039:14977098:1 | Same_strand|Intronic_coding|F20D1.3|F20D1.3 ## F20D1.3|protein_coding|F20D1.3|F20D1.3 [Source:RefSeq_peptide;Acc:NP_510486] ## {SimpF: WRM0620cC04 1 fosmid,WRM0619cC06 1 fosmid,WRM063bH10 1 fosmid,WRM0632dA05 1 fosmid,WRM0621dB08 1 fosmid,WRM0635cA06 1 fosmid,WRM0637bE01 1 fosmid,WRM061cA02 1 fosmid,WRM065aD05 1 fosmid,WRM0618cH08 1 fosmid,WRM0625cA03 1 fosmid,CEOPX130 1 Operon} ## {MIR: cel-mir-1829b} |
| cremanei | chromosome:chrUn:20215887:20215986:-1 | intergenic |
| cbriggsae | chromosome:chrV:5457695:5457794:1 | Opposite_strand|Intronic_coding|NM_001027169 ## Same_strand|Intronic_coding|NM_070877 ## Same_strand|Exonic_coding|NM_073185 |
cel-mir-798
| absolute | CE1 |
| cel-mir-798 3arm | 1 |
| normalized | CE1 |
| cel-mir-798 3arm | 0.001 |
block4759 (miRBase cel-mir-798) [miRNAknown]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-798 | 0.042 | no | no | 0.33/0.35 | 20/21/1.00 | 0.0 | 0.0 | 1 | 0 | 1 | 0 | 6 | 7 | 3arm | 1 | nd | 0.19 | 2 | 1 | 1 | na | na |
| reads | miRBase family seed | ||
| seed | --------------------------------------------------AAGCCUU------------------- | 1 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| -------------------------------------------------TAAGCCTTACATATTGACTG------- | 20 | 1 | |
| cel-miR-798 | -------------------------------------------------TAAGCCTTACATATTGACTGA------ | 21 | - |
| celegans | tactgtttcatgtaggtgttaaagtttgtacaagaagttagttttctgtTAAGCCTTACATATTGACTGAgcagta | ||
| **************************************************************************** | |||
| -------------------------------------------------------------------------------------- | Y64G10A.6 Y64G10A.6 Y64G10A.6 | ||
| celegans | (((((((.((.((..(((((((.(((((.(((.((((.....)))))))))))).))).))))..))))))))))) | 1.000 -17.30 |
| celegans | chromosome:IV:14277279:14277354:-1 | Opposite_strand|Intronic_coding|Y64G10A.6|Y64G10A.6 ## Y64G10A.6|protein_coding|Y64G10A.6|Y64G10A.6 [Source:RefSeq_peptide;Acc:NP_502736] ## {SimpF: WRM0622cB11 -1 fosmid,yk270d3 -1 RNAi,WRM0640cD11 -1 fosmid,WRM0634bA12 -1 fosmid,WRM0629aH01 -1 fosmid,WRM0616aE08 -1 fosmid,WRM0618cA09 -1 fosmid,WRM0611cG08 -1 fosmid} ## {MIR: cel-mir-798} |
miRNAknown_cloningHIGH_multiarm_randfoldOK (1 loci)
cel-mir-87
| absolute | CE1 |
| cel-mir-87 5arm | 1 |
| cel-mir-87 3arm | 171 |
| normalized | CE1 |
| cel-mir-87 5arm | 0.001 |
| cel-mir-87 3arm | 0.119 |
sblock57 (miRBase cel-mir-87) [miRNAknown_cloningHIGH_multiarm_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-87 | 0.001 | no | no | 0.45/0.55 | 18/22/0.98 | 0.0 0.0 | 0.0 0.0 | 1 145 | 0 0 | 1 1 | 0 0 | 40 12 | -15 9 | 5arm_loop_3arm 3arm | 1 1 | nd nd | 0.40 0.09 | 6 1 | 172 | 1 | na | na |
| Member of family miR-233/356/87 (seed UGAGCAA): cel-mir-233, cel-mir-87 |
| reads | miRBase family seed | ||
| seed | -----------------------------------------------------------------------------------UGAGCAA------------------------------------------ | 166 | miR-233/356/87 |
| seed | ------------------------------------------------------------------------------------GAGCAAA----------------------------------------- | 3 | novel |
| seed | ---------------------------------------------------------------------------------------CAAAGUU-------------------------------------- | 2 | novel |
| seed | -------------------------------------------------------------GCUG--UCA-------------------------------------------------------------- | 1 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| cel-miR-87 | ----------------------------------------------------------------------------------GTGAGCAAAGTTTCAGGTGTGC---------------------------- | 22 | 145 |
| ----------------------------------------------------------------------------------GTGAGCAAAGTTTCAGGTGTG----------------------------- | 21 | 18 | |
| -----------------------------------------------------------------------------------TGAGCAAAGTTTCAGGTGTGC---------------------------- | 21 | 3 | |
| ----------------------------------------------------------------------------------GTGAGCAAAGTTTCAGGTGT------------------------------ | 20 | 2 | |
| --------------------------------------------------------------------------------------GCAAAGTTTCAGGTGTGC---------------------------- | 18 | 2 | |
| ----------------------------------------------------------------------------------GTGAGCAAAGTTTCAGGTG------------------------------- | 19 | 1 | |
| ------------------------------------------------------------CGCTG--TCAGATTGGTCGTAG-------------------------------------------------- | 20 | 1 | |
| celegans | -------------------GGTTGTG-CCATCCGGCCGCCTGATACTTTCGTCTCAACCTCGCTG--TCAGATTGGTCGTAGGTGAGCAAAGTTTCAGGTGTGCCGGAACACACCC---------------- | ||
| cbriggsae | -------------------GGTTGTGCCCACCCGGCCGCCTGATACTTTCGTCTCAACCTCGCTG--TCAGA-ATGTCGTAGGTGAGCAAAGTTTCAGGTGTGCCGGAACACACCC---------------- | ||
| cjaponica | ----------------------------------GCCGCCTGACACTTTCGTCTCAACCTCGCT---TCAGA-TGGCCGTAGGTGAGCAAAGTTTCAGGTGTGC---------------------------- | ||
| cbrenneri | -----------------------GTG-CCTTCCGGCCGCCTGATACTTTCGTCTCAACCTCGCTTC-TCTCA-TTGTCGTAGGTGAGCAAAGTTTCAGGTGTGCCGGAACACAC------------------ | ||
| ppacificus | -----------------GGGGTGACGTCATGCTCGTCGCCTGA-ACTTGTA-CTCAACCTCGTCA--ATAGA-TGAGCGCAGGTGAGCAAAGTTTCAGGTGTGCGAGCTAGCGTCCCCC------------- | ||
| cremanei | AAACTTCTTCATCCATACAGGTTGTG-CCTTCCGGCCGCCTGACACTTTCGTCTCAACCTCGCTGTCTGATA-TAGTCGTAGGTGAGCAAAGTTTCAGGTGTGCCGGAACACATCCTCACTTTGCCCAGTTT | ||
| * ******* **** ********** * ** ************************ | |||
| +++++ +++++++ ++++++++++++++++++++++++++++++++++++++ +++++++++++++++++++++++++++++++++++++++++++++++++ +++++ | F10C2.2 F10C2.2 kup-1 | ||
| celegans | (((.((( ...(((((((((((((.(((((.(.((((.(((((((( ......))).)).))))))))))))).))))))).)))))).)))))). | 1.000 -44.60 | |
| cbriggsae | ((.((((.....((((((((((((.(((((...(((.((((((.(( (.... ))).)).))))))).))))).))))))).)))))..)))))). | 0.994 -38.10 | |
| cjaponica | (((((((((.(((((...(((.(((((((( ..... .)).)).))))))).))))).))))))).)) | 1.000 -26.20 | |
| cbrenneri | ((( ..((((((((((((((.(((((...(((.((((((.... ..... ....)).))))))).))))).))))))).)))))))))).. | 0.999 -38.02 | |
| ppacificus | ((((.(((((...((((((((((((( ((((... (((.((((((((( ..... ))).)).)))))))..))))).)))))).))))))..))))))))) | 1.000 -50.30 | |
| cremanei | ..................(((.(((( ..((((((((((((((.(((((...(((.((((((((((.....) ))).)).))))))).))))).))))))).))))))))))).)))............... | 0.918 -47.30 |
| celegans | chromosome:V:12038665:12038758:-1 | Same_strand|Intronic_coding|F10C2.2|F10C2.2 ## F10C2.2|protein_coding|kup-1|kup-1 encodes a novel protein that is conserved in C. briggsae, but contains no other known homologs. kup-1 is the upstream gene in an operon with pkc-1, which encodes two protein kinase C isoforms of the nPKC isotype. the polycistronic kup-1/pkc-1 mRNA is detected at low levels in embryos and larvae, but its expression greatly increases in adults. as loss of kup-1 activity via large-scale RNAi screens does not result in any obvious abnormalities, the precise role of kup-1 in C. elegans development and/or behavior is not yet known. [Source: WormBase] ## {SimpF: CEOP5312 1 Operon,WRM0626bF07 -1 fosmid,WRM063aG10 -1 fosmid,WRM0621bH11 -1 fosmid,WRM0622bH03 -1 fosmid} ## {MIR: cel-mir-87} |
| cbriggsae | chromosome:chrV:6389696:6389789:1 | Same_strand|Intronic_coding|NM_031366 ## Opposite_strand|Intronic_coding|NM_001087279 ## {MIR: cbr-mir-87} |
| cjaponica | chromosome:chrUn:17231967:17232100:1 | intergenic |
| cbrenneri | chromosome:chrUn:83992867:83992954:1 | Same_strand|Intronic_coding|NM_073615 |
| ppacificus | chromosome:chrUn:113454284:113454380:-1 | Same_strand|Intronic_coding|NM_001014737 |
| cremanei | chromosome:chrUn:126942557:126942686:-1 | Same_strand|Intronic_coding|NM_073615 |
miRNAknown_cloningHIGH_nonpairedHIGH (1 loci)
cel-mir-52
| absolute | CE1 |
| cel-mir-52 5arm | 2168 |
| normalized | CE1 |
| cel-mir-52 5arm | 1.515 |
block5886 (miRBase cel-mir-52) [miRNAknown_cloningHIGH_nonpairedHIGH]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-52 | 0.116 | no | no | 0.44/0.52 | 18/25/0.97 | 0.0 | 0.0 | 1773 | 0 | 1 | 0 | 16 | 4 | 5arm | 1 | nd | 0.33 | 3 | 2168 | 1 | na | na |
| Member of family miR-51/52/55 (seed ACCCGUA): cel-mir-53, cel-mir-51, cel-mir-55, cel-mir-54, cel-mir-56, cel-mir-52 |
| reads | miRBase family seed | ||
| seed | ----------------------------------ACCCGUA--------------------------------------------------------------------------------------------- | 2119 | miR-51/52/55 |
| seed | --------------------------------------GUACAUA----------------------------------------------------------------------------------------- | 30 | novel |
| seed | -----------------------------------CCCGUAC-------------------------------------------------------------------------------------------- | 12 | novel |
| seed | ------------------------------------CCGUACA------------------------------------------------------------------------------------------- | 5 | novel |
| seed | -------------------------------------CGUACAU------------------------------------------------------------------------------------------ | 2 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| cel-miR-52 | ---------------------------------CACCCGTACATATGTTTCCGTGCT----------------------------------------------------------------------------- | 24 | 1773 |
| ---------------------------------CACCCGTACATATGTTTCCGTGC------------------------------------------------------------------------------ | 23 | 248 | |
| ---------------------------------CACCCGTACATATGTTTCCGTGCTT---------------------------------------------------------------------------- | 25 | 50 | |
| -------------------------------------CGTACATATGTTTCCGTGCT----------------------------------------------------------------------------- | 20 | 25 | |
| ---------------------------------CACCCGTACATATGTTTCCGTG------------------------------------------------------------------------------- | 22 | 17 | |
| ---------------------------------CACCCGTACATATGTTTCCG--------------------------------------------------------------------------------- | 20 | 17 | |
| ----------------------------------ACCCGTACATATGTTTCCGTGCT----------------------------------------------------------------------------- | 23 | 12 | |
| ---------------------------------CACCCGTACATATGTTTCCGT-------------------------------------------------------------------------------- | 21 | 8 | |
| -----------------------------------CCCGTACATATGTTTCCGTGCT----------------------------------------------------------------------------- | 22 | 5 | |
| -------------------------------------CGTACATATGTTTCCGTGC------------------------------------------------------------------------------ | 19 | 5 | |
| ---------------------------------CACCCGTACATATGTTTCC---------------------------------------------------------------------------------- | 19 | 5 | |
| ------------------------------------CCGTACATATGTTTCCGTGCT----------------------------------------------------------------------------- | 21 | 2 | |
| ---------------------------------CACCCGTACATATGTTTC----------------------------------------------------------------------------------- | 18 | 1 | |
| celegans | -----------------TCCAACTCTAACAGTCCACCCGTACATATGTTTCCGTGCTTGACAGCGAAGCTCAATCACGTT-ACAATGAAAGGGTAGCCGGTTATTGAAGTTGGGTCTT---------------- | ||
| cbriggsae | ----------------TTCCCGCTCTGACAGTCCACCCGTACATATGTTTCCGTGCTTGACA-TAGAGCTCAATCACGAT-ACAATGAGCGGGTAGCCGGTCATCG-AGTCGGAA------------------- | ||
| cjaponica | TATT------TCGACGCTCCTCCAACGACAGACCACCCGTACATATGTTTCCGTGCTTGACTCTACGCCTCAATCACGTTAACAATTTATGGTTCGCCGGTCACG--AGTTGAGCTTTTGCGTTTGATG----- | ||
| cbrenneri | TATTGGCTAGTATTCTTTTCGGCTCTGACAGTCCACCCGTACATATGTTTCCGTGCTTGACAAT-GAGTTCAATCACGTC-ACAATTTATGGGTCGCCGGTCATTG-AGTTGAACATTTGAACCAGATCTAATA | ||
| cremanei | -----------------ACCCTCTACTACCGTCCACCCGTACATATGTTTCCGTGCTTGACATT-GTGCTCAATCACGTT-ACAATATATGGGTCGCCGGTCTT---AGGCGGT-------------------- | ||
| * * ** * ***************************** ********* ***** ** * ****** ** * | |||
| celegans | ((((((((((((.(.(.((((...(((.(((...((((.(((((......).)))).)))).. ))))))...)))).).).))))..).))))))).... | 1.000 -25.70 | |
| cbriggsae | .(((.((((((((.....((((((.(((.(((...((((.((((.. ......)))).)))).. )))))).)))))).....))))..) ))).))). | 1.000 -33.90 | |
| cjaponica | .... (((((((..((.((((....((((...((..((((((((..((((.((((.........)))).))))..))))...))))...))..))))... .)))))).....))))).)).. | 0.979 -29.10 | |
| cbrenneri | ((((((......(((..((((((((((((.....(((((((.((.(((...((((.((((.... ....)))).)))).. ))))).))))))).....))))..) ))))))).....)))......)))))) | 0.838 -31.90 | |
| cremanei | (((.((((..((((...(((((((.((.(((...((((.((((.... ....)))).)))).. ))))).)))))))...))))..) ))).))) | 1.000 -28.80 |
| celegans | chromosome:IV:14033976:14034075:1 | intergenic ## {SimpF: WRM0634bF10 1 fosmid,WRM0631dC06 1 fosmid,WRM0614cF04 1 fosmid,WRM0628aF10 1 fosmid} ## {MIR: cel-mir-52} |
| cbriggsae | chromosome:chrIV:5731131:5731226:1 | Same_strand|Intronic_coding|NM_001106790 ## Opposite_strand|Intronic_coding|NM_001128722 ## {MIR: cbr-mir-52} |
| cjaponica | chromosome:chrUn:11282764:11282884:1 | intergenic |
| cbrenneri | chromosome:chrUn:102731927:102732057:1 | intergenic |
| cremanei | chromosome:chrUn:56827927:56828018:-1 | Opposite_strand|Intronic_coding|NM_069625 |
miRNAknown_lenNOK_cloningOK_multiarm_DicerNOK_randfoldOK (1 loci)
cel-mir-253
| absolute | CE1 |
| cel-mir-253 5arm | 1 |
| cel-mir-253 3arm | 6 |
| normalized | CE1 |
| cel-mir-253 5arm | 0.001 |
| cel-mir-253 3arm | 0.004 |
sblock53 (miRBase cel-mir-253) [miRNAknown_lenNOK_cloningOK_multiarm_DicerNOK_randfoldOK]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-253 | 0.001 | no | no | 0.44/0.55 | 18/22/0.67 | 0.0 nd 0.0 | 0.0 nd 2.3 | 1 0 6 | 0 0 0 | 1 0 1 | 0 0 0 | 24 27 22 | 7 1 10 | 5arm 5arm 3arm | 1 1 1 | nd nd nd | 0.11 0.19 0.18 | 1 2 2 | 7 | 1 | 8 | 9 |
| reads | miRBase family seed | ||
| seed | --------------------------------------------------------------------------------------UAGUAGG------------------------------------------------- | 6 | novel |
| seed | ----------------------------------------------CACACAC----------------------------------------------------------------------------------------- | 1 | novel |
| seed | -------------------------------------------------ACACCUC-------------------------------------------------------------------------------------- | 0 | miR-253 |
| len | cloning frequencies | ||
| CE1 | |||
| -------------------------------------------------------------------------------------TTAGTAGGCGTTGTGGGAAGGG----------------------------------- | 22 | 2 | |
| cel-miR-253 | -------------------------------------------------------------------------------------TTAGTAGGCGTTGTGGGAAGG------------------------------------ | 21 | 2 |
| -------------------------------------------------------------------------------------TTAGTAGGCGTTGTGGGA--------------------------------------- | 18 | 2 | |
| ---------------------------------------------TCACACACCTCACTAACA------------------------------------------------------------------------------- | 18 | 1 | |
| cel-miR-253* | ------------------------------------------------CACACCTCACTAACACTGA-CC------------------------------------------------------------------------ | 21 | - |
| celegans | ---------------------GAATTGTTCCGATCGCCGCTCTTTTCACACACCTCACTAACACTGA-CCACCGATGCATAGATGTTAGTAGGCGTTGTGGGAAGGGCGGCGACAGTGAACGTCGTTTC------------- | ||
| cbriggsae | ---------TTTTAATTAACAACATTTTTCGAGTTTCAGTCCTTCTCACACACCTCACTAACACTAA-CTACAGATTTCTAGATGTTAGTAGGCGTTGTGGGAAGGGCGGAGATGACGAATACTTTGTGCAATTGAAG---- | ||
| cjaponica | GTAATCGGATTGTTTTTTGTTGAATATTTCGAGTTGCAGCCATTCTCACACACCTCACTATCACAGA--CGCGATCGTCTAGATGTTAGTAGGCGTTGTGGGAAGGGCGGCGATGGCGAAAAGTTTGGAAACATGTGATAAC | ||
| cbrenneri | --------------TCCTGAATACTCATTCGATGTTCCACCCTTTTCACACACCTGACTAACACAAAACCGCAGATGTATTGATGTTAGTAGGCGTTGTGGGAAGGGTGGCGATGATGAGCATATTTTCATGA--------- | ||
| cremanei | ---------------------------------------CCCTTTTCACACACCTCACTAACACTAA-ACACAGATTGATAGATGTTAGTAGGCGTTGTGGGAAGGG----------------------------------- | ||
| ** ********** **** *** * * * ************************** | |||
| +++++ ++++++++++++++++++++++++++++++++++++++++++++++ +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ +++++ | F44E7.5b F44E7.5 F44E7.5 | ||
| +++++ ++++++++++++++++++++++++++++++++++++++++++++++ +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ +++++ | F44E7.5a F44E7.5 F44E7.5 | ||
| celegans | ((...(((((..(((((((((((..(((((.(((.((((((((((. .((....))..))).)))))))))).).))))..)))))))))))..).)))).))..... | 1.000 -47.90 | |
| cbriggsae | .(((((((.((((.....((((.(((((.(((((((((((((.(((.((((((((((. ...........))).)))))))))).)).))))))))))).)))))..))))....))))..))))))). | 1.000 -46.10 | |
| cjaponica | ...((((.((.((((((....((((.(((((.(((((.(((.(((((((((.(((.((((.((.((( ((....)))))...)).))))))).)).))))))).))).)))))..))))).)))))))))))).))))... | 0.997 -48.00 | |
| cbrenneri | ((.((((..((((((....(((((((((((..(((((.(((.((((((((((.((.......)).))).)))))))))).)).)))..)))))))).)))))))))......)))).)) | 0.985 -43.10 | |
| cremanei | (((((..(((((.(((.((((((((((. ...........))).)))))))))).)).)))..))))) | 1.000 -27.40 |
| celegans | chromosome:V:5780493:5780599:-1 | Same_strand|Intronic_coding|F44E7.5a|F44E7.5 ## F44E7.5|protein_coding|F44E7.5|F44E7.5b [Source:RefSeq_peptide;Acc:NP_872177] ## {SimpF: WRM0634bH03 -1 fosmid,WRM0641cE05 -1 fosmid,WRM0629cG12 -1 fosmid,WRM0632dC09 -1 fosmid} ## {MIR: cel-mir-253} |
| cbriggsae | chromosome:chrV:9138929:9139056:-1 | Same_strand|Intronic_coding|NM_001011629 ## Opposite_strand|Intronic_coding|NM_062593 ## {MIR: cbr-mir-253} |
| cjaponica | chromosome:chrUn:55160315:55160454:1 | intergenic |
| cbrenneri | chromosome:chrUn:46020867:46020985:-1 | Same_strand|Intronic_coding|NM_072114 |
| cremanei | chromosome:chrUn:141474098:141474244:-1 | Same_strand|Intronic_coding|NM_072673 |
miRNAknown_lenNOK_cloningOK_multiarm_DicerNOK_shortStem (1 loci)
cel-mir-1829a
| absolute | CE1 |
| cel-mir-1829a 5arm | 3 |
| cel-mir-1829a 3arm | 4 |
| normalized | CE1 |
| cel-mir-1829a 5arm | 0.002 |
| cel-mir-1829a 3arm | 0.003 |
sblock68 (miRBase cel-mir-1829a) [miRNAknown_lenNOK_cloningOK_multiarm_DicerNOK_shortStem]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-1829a | 0.011 | no | no | 0.32/0.38 | 19/22/0.50 | 0.0 0.0 | 0.3 0.0 | 3 4 | 0 0 | 1 1 | 0 0 | 0 3 | 2 3 | 5arm 3arm | 1 1 | nd nd | 0.14 0.16 | 1 1 | 7 | 1 | 1 | -1 |
| reads | miRBase family seed | ||
| seed | -------------------------------------------AACCAUU------------------- | 4 | novel |
| seed | -A----GGGGAC--------------------------------------------------------- | 3 | novel |
| len | cloning frequencies | ||
| CE1 | |||
| ------------------------------------------CAACCATTGGAATTTCTCT-------- | 19 | 4 | |
| AA----GGGGACTTCTAATTGTTTG-------------------------------------------- | 21 | 2 | |
| AA----GGGGACTTCTAATTGTTTGT------------------------------------------- | 22 | 1 | |
| cel-miR-1829a | ------------------------------------------CAACCATTGGAATTTCTCTATT----- | 22 | - |
| celegans | AA----GGGGACTTCTAATTGTTTGTAAAAAATCGAGTATTACAACCATTGGAATTTCTCTATT----- | ||
| cjaponica | AAAATCGGGGAA----AAATGTTTGAAAAAAAT---ATATTTCAACCAT-----TTTTTACACGACCAC | ||
| ** ***** ** ****** ******* **** ******* *** * * | |||
| +++++++ ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ +++++ | K09A9.5 K09A9.5 gas-1 | ||
| celegans | .( (((((.(((((((.(((.((((...........))))))).))))))).))))))... | 1.000 -14.10 | |
| cjaponica | ....(((..((( (((((.((((((..... ...)))))).))) )))))...))).... | 1.000 -13.20 |
| celegans | chromosome:X:15588233:15588292:-1 | Same_strand|Intronic_coding|K09A9.5|K09A9.5 ## K09A9.5|protein_coding|gas-1|The gas-1 gene encodes a 49 kDa subunit of mitochondrial complex I that is required for oxidative phosphorylation, resistance to volatile anesthetics, fecundity, and normal lifespan. gas-1 is expressed in the nematode neuromuscular system. its subcellular distribution appears to be mitochondrial. drug effects on mutants versus wild-type indicate that gas-1 functions at least partially through presynaptic effects. gas-1 mutants have strongly reduced Complex I-dependent metabolism in mitochondria, while Complex II-dependent metabolism is conversely increased in mutants. gas-1 mitochondria look structurally normal. [Source: WormBase] ## {SimpF: WRM061cB03 -1 fosmid,WRM0611bC07 -1 fosmid,WRM0628aD06 -1 fosmid,WRM0614bD09 -1 fosmid} ## {MIR: cel-mir-1829a} |
| cjaponica | chromosome:chrUn:89502738:89502837:1 | Same_strand|Intronic_coding|NM_005587 |
miRNAknown_randfoldOK_bulgeHIGH (1 loci)
cel-mir-787
| absolute | CE1 |
| cel-mir-787 3arm | 1 |
| normalized | CE1 |
| cel-mir-787 3arm | 0.001 |
block8488 (miRBase cel-mir-787) [miRNAknown_randfoldOK_bulgeHIGH]
| miRNA | randfold | RNA | rep | GC min/max | len min/max/mir_range | 5'var | 3'var | reads | reads edited | libs | libs edited | base distance | loop distance | position | locations | exon distance | unpaired | max bulge | total reads | total libs | dicer | drosha |
| miRBase cel-mir-787 | 0.001 | no | no | 0.35/0.35 | 23/23/1.00 | 0.0 | 0.0 | 1 | 0 | 1 | 0 | 14 | 6 | 3arm | 1 | nd | 0.22 | 4 | 1 | 1 | na | na |
| Member of family miR-231/787 (seed AAGCUCG): cel-mir-231, cel-mir-787 |
| reads | miRBase family seed | ||
| seed | -----------------------------------------------------------AAGCUCG-------------------------------------- | 1 | miR-231/787 |
| len | cloning frequencies | ||
| CE1 | |||
| cel-miR-787 | ----------------------------------------------------------TAAGCTCGTTTTAGTAT--CTTTCG--------------------- | 23 | 1 |
| celegans | ---GATGTATCAGTGGACGAAAGATAC-ATACGATCTTACATC-TTCAAAATGGTATGTAAGCTCGTTTTAGTAT--CTTTCGTCTCTG-------ATCACATT | ||
| cbriggsae | -----------TGGAGAAGAAGGAAACTAGACAATCTTACATAGCTCAAAATAATCTGTAAGCTCGTCTTAGTTTTCCTCTCCTCTCTA-------GGGAATAT | ||
| cbrenneri | GTGAGATTCTTGGTGGAAGAAAGGAACCATGCGATCTTACAACAATAAAAGTG---TGTAAGCTCGTCATTGTTT-CCTTTCTTCTCCAACTCACTGCTGTTCT | ||
| * ** *** * ** * * ******** * *** * *********** * ** * ** ** **** * | |||
| celegans | ((((((((((.((((((((((((( ..((((.(((((((( (.......)).))))))).))))....)))) )))))))))))) )).))))) | 1.000 -39.70 | |
| cbriggsae | ((((((.((((((((((((((...((((((...............))))))...)))).))))).))).)).)))))) ........ | 0.991 -22.96 | |
| cbrenneri | (((((....((((.(((((((((((((.((((((.(((((.(((.......)) )))))).))).))).))). )))))))))))))))))))......... | 1.000 -37.60 |
| celegans | chromosome:X:11294636:11294725:1 | intergenic ## {SimpF: WRM0628cG10 1 fosmid,WRM0610dC11 1 fosmid,WRM061aE05 1 fosmid} ## {MIR: cel-mir-787} |
| cbriggsae | chromosome:chrX:5375314:5375399:-1 | Opposite_strand|Intronic_coding|NM_001105250 ## Same_strand|Intronic_coding|NM_072374 ## {MIR: cbr-mir-787} |
| cbrenneri | chromosome:chrUn:55916:56015:1 | intergenic |
| Back to summary page | other miRBase miRNAs: | Page 1 | Page 2 |
©2008 InteRNA Genomics B.V.